Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0814748323:

Variant ID: vg0814748323 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 14748323
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCGGGTTGAGGATGTGATAGGCCTTCGAGCCCTCCGCGTAGCCGATGAACACCCCTGGGGTGCTCCTGTCGTCGAGCTTGCCGATGGGGCCAAGCTCCT[T/A]
GACGAACACGAGGCAGCCGAAGACCCGCAGGTGGGAGACCCCCGGCTTGCGCCCATGCCAAGCCTCGTACGGTGTCCTGCCATCGAGGGCCTTGGTAGGC

Reverse complement sequence

GCCTACCAAGGCCCTCGATGGCAGGACACCGTACGAGGCTTGGCATGGGCGCAAGCCGGGGGTCTCCCACCTGCGGGTCTTCGGCTGCCTCGTGTTCGTC[A/T]
AGGAGCTTGGCCCCATCGGCAAGCTCGACGACAGGAGCACCCCAGGGGTGTTCATCGGCTACGCGGAGGGCTCGAAGGCCTATCACATCCTCAACCCGGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.30% 1.50% 8.82% 32.42% NA
All Indica  2759 52.60% 0.70% 7.10% 39.54% NA
All Japonica  1512 57.00% 3.00% 12.63% 27.31% NA
Aus  269 88.50% 1.50% 8.92% 1.12% NA
Indica I  595 37.30% 0.00% 6.89% 55.80% NA
Indica II  465 32.90% 2.60% 11.61% 52.90% NA
Indica III  913 72.10% 0.70% 4.16% 23.11% NA
Indica Intermediate  786 53.30% 0.30% 8.02% 38.42% NA
Temperate Japonica  767 44.20% 1.00% 6.78% 47.98% NA
Tropical Japonica  504 71.00% 5.80% 20.24% 2.98% NA
Japonica Intermediate  241 68.50% 3.70% 15.35% 12.45% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 65.60% 0.00% 6.67% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0814748323 T -> A LOC_Os08g24410.1 stop_gained ; p.Lys773*; HIGH stop_gained Average:52.048; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg0814748323 T -> DEL LOC_Os08g24410.1 N frameshift_variant Average:52.048; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0814748323 T A 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0814748323 8.69E-06 9.97E-06 mr1600 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814748323 NA 8.13E-07 mr1078_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251