Search for Variation information by Variation ID:
Detailed information for vg0814644208:
| Variant ID: vg0814644208 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 14644208 |
| Reference Allele: T | Alternative Allele: G,C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 281. )
Flanking Sequence (100 bp) in Reference Genome:
GCTGGCCGTCAAATGCCAAAGATTAGAACATCTTCCAGGTATAAACCCCTTGGTACCATTTTATTTCGGCATGCTTCTCTCATGAAAATAATATTGAAGG[T/G,C]
TAAAAGAACACTTCGCAGGAAACCATCCGATATAGATCCAACTGGAAAAGATCCGGATCCGGCTGCGACAGAGCCAAATTTATCCAAAGATGCTGAGCCA
Reverse complement sequence
TGGCTCAGCATCTTTGGATAAATTTGGCTCTGTCGCAGCCGGATCCGGATCTTTTCCAGTTGGATCTATATCGGATGGTTTCCTGCGAAGTGTTCTTTTA[A/C,G]
CCTTCAATATTATTTTCATGAGAGAAGCATGCCGAAATAAAATGGTACCAAGGGGTTTATACCTGGAAGATGTTCTAATCTTTGGCATTTGACGGCCAGC
Allele Frequencies:
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.90% | 1.60% | 2.09% | 3.34% | G: 0.04% |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 78.00% | 5.00% | 6.42% | 10.45% | G: 0.07% |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 80.30% | 1.30% | 6.26% | 12.13% | NA |
| Tropical Japonica | 504 | 76.20% | 11.70% | 8.13% | 3.77% | G: 0.20% |
| Japonica Intermediate | 241 | 74.70% | 2.90% | 3.32% | 19.09% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 0.00% | 2.22% | 0.00% | G: 1.11% |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0814644208 | T -> G | LOC_Os08g24260.1 | missense_variant ; p.Val412Gly; MODERATE | nonsynonymous_codon ; V412G | Average:18.646; most accessible tissue: Minghui63 young leaf, score: 33.985 | benign  |
1.404 |
DELETERIOUS | 0.00 |
| vg0814644208 | T -> C | LOC_Os08g24260.1 | missense_variant ; p.Val412Ala; MODERATE | nonsynonymous_codon ; V412A | Average:18.646; most accessible tissue: Minghui63 young leaf, score: 33.985 | benign |
0.674 |
TOLERATED | 0.50 |
| vg0814644208 | T -> DEL | LOC_Os08g24260.1 | N | frameshift_variant | Average:18.646; most accessible tissue: Minghui63 young leaf, score: 33.985 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0814644208 | 4.86E-07 | 5.13E-08 | mr1238 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814644208 | 2.89E-07 | 2.07E-07 | mr1484 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814644208 | 7.96E-06 | NA | mr1841 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814644208 | NA | 2.32E-06 | mr1900 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814644208 | 2.43E-07 | 5.67E-08 | mr1238_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814644208 | 1.69E-06 | 1.69E-06 | mr1484_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814644208 | 2.94E-06 | 1.20E-06 | mr1841_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814644208 | NA | 9.85E-06 | mr1900_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0814644208 | 1.38E-06 | 1.38E-06 | mr1945_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |