Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0814220352:

Variant ID: vg0814220352 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 14220352
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.03, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

CAGTAAGAACTCCTTCAGGTTTGCCAGTACTCACCTAGAAGCATTTCATAGCTGTCAGCCACAGAGTGACCCTGATCTGCCATCTCTTAAAGTGCACACC[G/A]
GTGAATTTATCCGGCCTCAATGTATCGGCAAAACCAGCCATAGTAAAATCACAGTGCCTATAATAAGGTTTTTGGATTGTTGAGATTAAAGGCATATAAT

Reverse complement sequence

ATTATATGCCTTTAATCTCAACAATCCAAAAACCTTATTATAGGCACTGTGATTTTACTATGGCTGGTTTTGCCGATACATTGAGGCCGGATAAATTCAC[C/T]
GGTGTGCACTTTAAGAGATGGCAGATCAGGGTCACTCTGTGGCTGACAGCTATGAAATGCTTCTAGGTGAGTACTGGCAAACCTGAAGGAGTTCTTACTG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.30%	33.80%	7.47%	7.47%	NA
All Indica	2759	83.70%	15.10%	1.16%	0.04%	NA
All Japonica	1512	2.30%	70.60%	5.62%	21.43%	NA
Aus	269	16.40%	18.20%	63.94%	1.49%	NA
Indica I	595	96.80%	3.00%	0.17%	0.00%	NA
Indica II	465	86.90%	12.90%	0.00%	0.22%	NA
Indica III	913	76.70%	22.10%	1.20%	0.00%	NA
Indica Intermediate	786	80.00%	17.40%	2.54%	0.00%	NA
Temperate Japonica	767	2.00%	96.10%	0.00%	1.96%	NA
Tropical Japonica	504	2.20%	43.30%	13.49%	41.07%	NA
Japonica Intermediate	241	3.70%	46.90%	7.05%	42.32%	NA
VI/Aromatic	96	4.20%	22.90%	55.21%	17.71%	NA
Intermediate	90	35.60%	44.40%	12.22%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0814220352	G -> A	LOC_Os08g23480.1	upstream_gene_variant ; 18.0bp to feature; MODIFIER	silent_mutation	Average:32.828; most accessible tissue: Zhenshan97 flag leaf, score: 60.074	N	N	N	N
vg0814220352	G -> A	LOC_Os08g23490.1	upstream_gene_variant ; 2473.0bp to feature; MODIFIER	silent_mutation	Average:32.828; most accessible tissue: Zhenshan97 flag leaf, score: 60.074	N	N	N	N
vg0814220352	G -> A	LOC_Os08g23480-LOC_Os08g23490	intergenic_region ; MODIFIER	silent_mutation	Average:32.828; most accessible tissue: Zhenshan97 flag leaf, score: 60.074	N	N	N	N
vg0814220352	G -> DEL	N	N	silent_mutation	Average:32.828; most accessible tissue: Zhenshan97 flag leaf, score: 60.074	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0814220352	NA	1.46E-06	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814220352	NA	3.26E-06	mr1309	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814220352	NA	4.12E-08	mr1321	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814220352	NA	4.70E-09	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814220352	6.79E-07	3.26E-08	mr1484	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814220352	NA	8.10E-08	mr1841	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814220352	NA	7.53E-12	mr1914	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814220352	NA	7.84E-10	mr1945	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814220352	NA	7.24E-07	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251