Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0813547545:

Variant ID: vg0813547545 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 13547545
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

AAGTGATTTATACTGTCTCGGCATGGCGACCGATCTATCGCAATCACTTGATTTAAGTATATATCAATATAAGGAGTATATATTGTTAATATCTACAGCC[G/A]
ATCGAGTAGATCTAGTTCTTTCTTATTTATTTATGACTGCCGATCGATACATATATGACATCGGCTCAAAGATAAATGATATGTCATCGGCACTTAGCCG

Reverse complement sequence

CGGCTAAGTGCCGATGACATATCATTTATCTTTGAGCCGATGTCATATATGTATCGATCGGCAGTCATAAATAAATAAGAAAGAACTAGATCTACTCGAT[C/T]
GGCTGTAGATATTAACAATATATACTCCTTATATTGATATATACTTAAATCAAGTGATTGCGATAGATCGGTCGCCATGCCGAGACAGTATAAATCACTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.70%	12.20%	6.39%	20.72%	NA
All Indica	2759	54.90%	1.60%	10.29%	33.24%	NA
All Japonica	1512	69.70%	28.50%	0.26%	1.52%	NA
Aus	269	85.50%	0.00%	4.83%	9.67%	NA
Indica I	595	46.20%	0.50%	6.89%	46.39%	NA
Indica II	465	41.10%	1.90%	11.61%	45.38%	NA
Indica III	913	68.70%	2.00%	11.39%	17.96%	NA
Indica Intermediate	786	53.70%	1.70%	10.81%	33.84%	NA
Temperate Japonica	767	96.00%	2.30%	0.26%	1.43%	NA
Tropical Japonica	504	41.30%	58.10%	0.00%	0.60%	NA
Japonica Intermediate	241	45.60%	49.80%	0.83%	3.73%	NA
VI/Aromatic	96	13.50%	85.40%	0.00%	1.04%	NA
Intermediate	90	61.10%	24.40%	1.11%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0813547545	G -> A	LOC_Os08g22480.1	upstream_gene_variant ; 308.0bp to feature; MODIFIER	silent_mutation	Average:11.763; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0813547545	G -> A	LOC_Os08g22450-LOC_Os08g22480	intergenic_region ; MODIFIER	silent_mutation	Average:11.763; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0813547545	G -> DEL	N	N	silent_mutation	Average:11.763; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0813547545	NA	2.31E-12	mr1084	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813547545	NA	1.61E-12	mr1205	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813547545	NA	4.43E-12	mr1521	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813547545	2.84E-06	2.83E-06	mr1597	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813547545	NA	6.67E-07	mr1642	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813547545	NA	3.38E-09	mr1680	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0813547545	NA	3.70E-07	mr1851	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251