| Variant ID: vg0812794506 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 12794506 |
| Reference Allele: A | Alternative Allele: C,T |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.84, C: 0.16, others allele: 0.00, population size: 69. )
AATAGTTCCAAGTCCGCGGAGGCTTCGGGGAGTTCGGTAAAGGTTCTATAGCTTTTCCTTTCTTCTTTGTAAGACTTCCATTTATCAATATAATATTCTT[A/C,T]
TTTATACAAGTTCGGTACTTTATTCCAATCATAGACTATGAGTACCAGTCTTAGTTTATTCATAAGTAGTATAATCTGTGTAGTTAAACCTTCTGGGATT
AATCCCAGAAGGTTTAACTACACAGATTATACTACTTATGAATAAACTAAGACTGGTACTCATAGTCTATGATTGGAATAAAGTACCGAACTTGTATAAA[T/G,A]
AAGAATATTATATTGATAAATGGAAGTCTTACAAAGAAGAAAGGAAAAGCTATAGAACCTTTACCGAACTCCCCGAAGCCTCCGCGGACTTGGAACTATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.40% | 41.60% | 1.86% | 0.08% | T: 0.02% |
| All Indica | 2759 | 84.50% | 14.10% | 1.34% | 0.00% | NA |
| All Japonica | 1512 | 2.60% | 94.00% | 3.11% | 0.26% | NA |
| Aus | 269 | 95.20% | 3.30% | 1.12% | 0.00% | T: 0.37% |
| Indica I | 595 | 87.40% | 11.80% | 0.84% | 0.00% | NA |
| Indica II | 465 | 87.70% | 11.40% | 0.86% | 0.00% | NA |
| Indica III | 913 | 81.80% | 16.20% | 1.97% | 0.00% | NA |
| Indica Intermediate | 786 | 83.60% | 15.10% | 1.27% | 0.00% | NA |
| Temperate Japonica | 767 | 2.30% | 95.40% | 2.22% | 0.00% | NA |
| Tropical Japonica | 504 | 1.60% | 94.40% | 3.37% | 0.60% | NA |
| Japonica Intermediate | 241 | 5.40% | 88.80% | 5.39% | 0.41% | NA |
| VI/Aromatic | 96 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 37.80% | 61.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0812794506 | A -> C | LOC_Os08g21470.1 | upstream_gene_variant ; 1246.0bp to feature; MODIFIER | silent_mutation | Average:35.461; most accessible tissue: Minghui63 young leaf, score: 58.21 | N | N | N | N |
| vg0812794506 | A -> C | LOC_Os08g21474.1 | upstream_gene_variant ; 4506.0bp to feature; MODIFIER | silent_mutation | Average:35.461; most accessible tissue: Minghui63 young leaf, score: 58.21 | N | N | N | N |
| vg0812794506 | A -> C | LOC_Os08g21460.1 | downstream_gene_variant ; 722.0bp to feature; MODIFIER | silent_mutation | Average:35.461; most accessible tissue: Minghui63 young leaf, score: 58.21 | N | N | N | N |
| vg0812794506 | A -> C | LOC_Os08g21460-LOC_Os08g21470 | intergenic_region ; MODIFIER | silent_mutation | Average:35.461; most accessible tissue: Minghui63 young leaf, score: 58.21 | N | N | N | N |
| vg0812794506 | A -> T | LOC_Os08g21470.1 | upstream_gene_variant ; 1246.0bp to feature; MODIFIER | silent_mutation | Average:35.461; most accessible tissue: Minghui63 young leaf, score: 58.21 | N | N | N | N |
| vg0812794506 | A -> T | LOC_Os08g21474.1 | upstream_gene_variant ; 4506.0bp to feature; MODIFIER | silent_mutation | Average:35.461; most accessible tissue: Minghui63 young leaf, score: 58.21 | N | N | N | N |
| vg0812794506 | A -> T | LOC_Os08g21460.1 | downstream_gene_variant ; 722.0bp to feature; MODIFIER | silent_mutation | Average:35.461; most accessible tissue: Minghui63 young leaf, score: 58.21 | N | N | N | N |
| vg0812794506 | A -> T | LOC_Os08g21460-LOC_Os08g21470 | intergenic_region ; MODIFIER | silent_mutation | Average:35.461; most accessible tissue: Minghui63 young leaf, score: 58.21 | N | N | N | N |
| vg0812794506 | A -> DEL | N | N | silent_mutation | Average:35.461; most accessible tissue: Minghui63 young leaf, score: 58.21 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0812794506 | NA | 1.34E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812794506 | NA | 7.03E-07 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812794506 | NA | 7.09E-07 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812794506 | NA | 2.09E-09 | mr1342 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812794506 | 2.72E-06 | 2.72E-06 | mr1358 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812794506 | NA | 6.08E-10 | mr1379 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812794506 | 6.64E-06 | 5.25E-06 | mr1406 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812794506 | NA | 1.70E-17 | mr1566 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812794506 | NA | 6.49E-09 | mr1637 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812794506 | NA | 2.57E-06 | mr1733 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812794506 | 2.31E-06 | NA | mr1746 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812794506 | 1.04E-07 | 1.04E-07 | mr1900 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812794506 | NA | 8.88E-12 | mr1595_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812794506 | NA | 3.09E-08 | mr1600_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |