Search for Variation information by Variation ID:
Detailed information for vg0812614441:
| Variant ID: vg0812614441 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 12614441 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 286. )
Flanking Sequence (100 bp) in Reference Genome:
TCGTCTGGGAACACATCGGGATACTCCCGGACTATAGGAATCTCTTCCAAAGTTATTTGGTTCAGTCTTGACCTTAAAGGCTCAGAAGACAATGCATGAA[C/G]
AGTTACAACTCGACCATCATTACTGGTGATAGTTACTTTTCTGTTGGCACAGTCTATCACACCTTTATATCTGGCTAACCAGTCCATCCCTAAGATGACA
Reverse complement sequence
TGTCATCTTAGGGATGGACTGGTTAGCCAGATATAAAGGTGTGATAGACTGTGCCAACAGAAAAGTAACTATCACCAGTAATGATGGTCGAGTTGTAACT[G/C]
TTCATGCATTGTCTTCTGAGCCTTTAAGGTCAAGACTGAACCAAATAACTTTGGAAGAGATTCCTATAGTCCGGGAGTATCCCGATGTGTTCCCAGACGA
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.90% | 0.10% | 0.47% | 5.50% | NA |
| All Indica | 2759 | 98.40% | 0.00% | 0.00% | 1.59% | NA |
| All Japonica | 1512 | 87.70% | 0.50% | 1.19% | 10.65% | NA |
| Aus | 269 | 93.70% | 0.00% | 0.00% | 6.32% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.00% | 0.17% | NA |
| Indica II | 465 | 98.50% | 0.00% | 0.00% | 1.51% | NA |
| Indica III | 913 | 97.30% | 0.00% | 0.00% | 2.74% | NA |
| Indica Intermediate | 786 | 98.60% | 0.00% | 0.00% | 1.40% | NA |
| Temperate Japonica | 767 | 99.00% | 0.00% | 0.13% | 0.91% | NA |
| Tropical Japonica | 504 | 79.40% | 1.00% | 1.98% | 17.66% | NA |
| Japonica Intermediate | 241 | 69.30% | 0.80% | 2.90% | 26.97% | NA |
| VI/Aromatic | 96 | 61.50% | 0.00% | 4.17% | 34.38% | NA |
| Intermediate | 90 | 94.40% | 0.00% | 0.00% | 5.56% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0812614441 | C -> G | LOC_Os08g21110.1 | missense_variant ; p.Val1120Leu; MODERATE | nonsynonymous_codon ; V1120L | Average:27.022; most accessible tissue: Minghui63 flag leaf, score: 45.195 | benign  |
0.876 |
DELETERIOUS | 0.01 |
| vg0812614441 | C -> DEL | LOC_Os08g21110.1 | N | frameshift_variant | Average:27.022; most accessible tissue: Minghui63 flag leaf, score: 45.195 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0812614441 | NA | 9.99E-07 | mr1232_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812614441 | NA | 4.97E-06 | mr1415_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812614441 | 5.91E-07 | 5.91E-07 | mr1424_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812614441 | NA | 2.66E-07 | mr1557_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812614441 | 3.03E-07 | 3.03E-07 | mr1562_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812614441 | NA | 2.45E-06 | mr1884_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0812614441 | NA | 7.67E-07 | mr1944_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |