RiceVarMap2

Detailed information for vg0812104133:

Variant ID: vg0812104133 (JBrowse)

Variation Type: SNP

Chromosome: chr08

Position: 12104133

Reference Allele: C

Alternative Allele: T

Primary Allele: C

Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCAGACCGGCCTACTTGAAGGAAACCCGTCACTTTCCAAACTTTGGCAATTTTCCCCTATTTCGTCCATAGGTGCCAAATTTGGGTGTAAACACATGCCC[C/T]
CCTGCCTTTTTGGTGAACATACGTGAACCTAAAAGCATAGAACATGTTATCTCTGGGCGATAATCCAATTACCGGCCATAGGACTTCCTAAGCATCTTGT

Reverse complement sequence

ACAAGATGCTTAGGAAGTCCTATGGCCGGTAATTGGATTATCGCCCAGAGATAACATGTTCTATGCTTTTAGGTTCACGTATGTTCACCAAAAAGGCAGG[G/A]
GGGCATGTGTTTACACCCAAATTTGGCACCTATGGACGAAATAGGGGAAAATTGCCAAAGTTTGGAAAGTGACGGGTTTCCTTCAAGTAGGCCGGTCTGA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.50%	11.40%	2.35%	5.82%	NA
All Indica	2759	91.40%	0.20%	2.94%	5.44%	NA
All Japonica	1512	62.20%	28.30%	1.46%	8.00%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	98.00%	0.00%	0.00%	2.02%	NA
Indica II	465	94.80%	0.20%	1.08%	3.87%	NA
Indica III	913	85.20%	0.20%	6.68%	7.89%	NA
Indica Intermediate	786	91.60%	0.40%	1.91%	6.11%	NA
Temperate Japonica	767	97.40%	2.30%	0.00%	0.26%	NA
Tropical Japonica	504	17.30%	57.70%	3.77%	21.23%	NA
Japonica Intermediate	241	44.40%	49.40%	1.24%	4.98%	NA
VI/Aromatic	96	7.30%	85.40%	6.25%	1.04%	NA
Intermediate	90	72.20%	23.30%	1.11%	3.33%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0812104133	C -> T	LOC_Os08g20180.1	downstream_gene_variant ; 123.0bp to feature; MODIFIER	silent_mutation	Average:52.033; most accessible tissue: Zhenshan97 flag leaf, score: 68.25	N	N	N	N
vg0812104133	C -> T	LOC_Os08g20170-LOC_Os08g20180	intergenic_region ; MODIFIER	silent_mutation	Average:52.033; most accessible tissue: Zhenshan97 flag leaf, score: 68.25	N	N	N	N
vg0812104133	C -> DEL	N	N	silent_mutation	Average:52.033; most accessible tissue: Zhenshan97 flag leaf, score: 68.25	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0812104133	NA	4.63E-09	mr1022	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812104133	6.68E-06	NA	mr1778	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 2 of 2 entries

Previous1Next

Contact

Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China

Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/

Search for Variation information by Variation ID:

Detailed information for vg0812104133:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact