Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0812096324:

Variant ID: vg0812096324 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 12096324
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGCGGTCAACCAGATTCACCGTGATTAGTTTCACCATAGTCTAGTCTAATGGAATTGAATAGTATAGGTGGATGGTTGGGCCTGTTGCAACGTGGTGTAG[T/C]
GTTGGACAGTGGATGTTTAATATTGATTAATTATTACAAATGTTTTACTGCTTCCAACTACTGTTTATAAATGCTCGCTTTATGCAAATGAACCACTATA

Reverse complement sequence

TATAGTGGTTCATTTGCATAAAGCGAGCATTTATAAACAGTAGTTGGAAGCAGTAAAACATTTGTAATAATTAATCAATATTAAACATCCACTGTCCAAC[A/G]
CTACACCACGTTGCAACAGGCCCAACCATCCACCTATACTATTCAATTCCATTAGACTAGACTATGGTGAAACTAATCACGGTGAATCTGGTTGACCGCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.60%	18.10%	0.74%	7.62%	NA
All Indica	2759	89.80%	0.90%	0.69%	8.63%	NA
All Japonica	1512	38.20%	53.60%	0.73%	7.47%	NA
Aus	269	99.30%	0.40%	0.00%	0.37%	NA
Indica I	595	97.00%	0.70%	0.34%	2.02%	NA
Indica II	465	91.60%	0.90%	2.58%	4.95%	NA
Indica III	913	83.40%	1.00%	0.44%	15.22%	NA
Indica Intermediate	786	90.70%	1.00%	0.13%	8.14%	NA
Temperate Japonica	767	15.10%	84.50%	0.13%	0.26%	NA
Tropical Japonica	504	61.90%	17.10%	1.59%	19.44%	NA
Japonica Intermediate	241	62.20%	31.50%	0.83%	5.39%	NA
VI/Aromatic	96	92.70%	0.00%	3.12%	4.17%	NA
Intermediate	90	72.20%	21.10%	2.22%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0812096324	T -> C	LOC_Os08g20170.1	downstream_gene_variant ; 2665.0bp to feature; MODIFIER	silent_mutation	Average:20.505; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg0812096324	T -> C	LOC_Os08g20170-LOC_Os08g20180	intergenic_region ; MODIFIER	silent_mutation	Average:20.505; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg0812096324	T -> DEL	N	N	silent_mutation	Average:20.505; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0812096324	NA	6.16E-06	mr1049	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812096324	NA	1.46E-08	mr1708	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812096324	7.78E-06	6.68E-08	mr1708	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812096324	NA	1.35E-09	mr1864	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0812096324	NA	2.08E-06	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251