Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0811932204:

Variant ID: vg0811932204 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 11932204
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCTGCGAGTTCTTTAGATTTTGCTGGAATGAGGGTATGAGGTTGCCATCTATCGAGGACTGTCCTGGGTGCGGTAATGTTGCAGAAAGTTCAAGCTGATC[G/A]
TATAATAGAGGCAATTGGCTAAAGCAAACAAGGGTTCCTGTTCATCAAAGGTTGGGCCCGGTGAACCAAGATCGTAACCAAGATGACAATGAAGACAGGA

Reverse complement sequence

TCCTGTCTTCATTGTCATCTTGGTTACGATCTTGGTTCACCGGGCCCAACCTTTGATGAACAGGAACCCTTGTTTGCTTTAGCCAATTGCCTCTATTATA[C/T]
GATCAGCTTGAACTTTCTGCAACATTACCGCACCCAGGACAGTCCTCGATAGATGGCAACCTCATACCCTCATTCCAGCAAAATCTAAAGAACTCGCAGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.50%	9.30%	4.70%	14.43%	NA
All Indica	2759	83.80%	9.60%	4.31%	2.32%	NA
All Japonica	1512	53.60%	10.40%	2.18%	33.80%	NA
Aus	269	75.10%	1.10%	18.22%	5.58%	NA
Indica I	595	84.20%	2.40%	8.40%	5.04%	NA
Indica II	465	88.00%	5.60%	3.87%	2.58%	NA
Indica III	913	82.10%	16.80%	0.88%	0.22%	NA
Indica Intermediate	786	82.80%	9.20%	5.47%	2.54%	NA
Temperate Japonica	767	87.20%	0.40%	1.96%	10.43%	NA
Tropical Japonica	504	11.70%	27.20%	2.78%	58.33%	NA
Japonica Intermediate	241	34.40%	7.10%	1.66%	56.85%	NA
VI/Aromatic	96	7.30%	8.30%	11.46%	72.92%	NA
Intermediate	90	55.60%	8.90%	11.11%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0811932204	G -> A	LOC_Os08g19910.1	upstream_gene_variant ; 4473.0bp to feature; MODIFIER	silent_mutation	Average:16.324; most accessible tissue: Callus, score: 30.592	N	N	N	N
vg0811932204	G -> A	LOC_Os08g19930.1	upstream_gene_variant ; 3054.0bp to feature; MODIFIER	silent_mutation	Average:16.324; most accessible tissue: Callus, score: 30.592	N	N	N	N
vg0811932204	G -> A	LOC_Os08g19920.1	intron_variant ; MODIFIER	silent_mutation	Average:16.324; most accessible tissue: Callus, score: 30.592	N	N	N	N
vg0811932204	G -> DEL	N	N	silent_mutation	Average:16.324; most accessible tissue: Callus, score: 30.592	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0811932204	8.15E-06	2.40E-08	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811932204	NA	1.44E-06	mr1309	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811932204	NA	6.40E-06	mr1602	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811932204	3.04E-06	2.39E-09	mr1841	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811932204	1.82E-07	1.82E-07	mr1900	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811932204	4.57E-07	1.05E-08	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811932204	1.49E-08	1.94E-09	mr1484_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811932204	2.89E-06	2.67E-09	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811932204	NA	1.22E-07	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251