Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0811931786:

Variant ID: vg0811931786 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 11931786
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACTTTGATATTACCAAGGCTGACAAGATTTTTGATTTGCTACTCTGAGAGAAGTAGATTCAACTTCCTGTTGGTCATACAATTCCATCGGCTGAAGAATT[G/A]
GGCAAGAGAAGGTATTGCTAGTGGCATAATTCTGGGTCTCATTCTACCAATGATTTCAAGGTTTTCAGGCTGCAGATCCAAGCAGCCATTGAGGGAGGCA

Reverse complement sequence

TGCCTCCCTCAATGGCTGCTTGGATCTGCAGCCTGAAAACCTTGAAATCATTGGTAGAATGAGACCCAGAATTATGCCACTAGCAATACCTTCTCTTGCC[C/T]
AATTCTTCAGCCGATGGAATTGTATGACCAACAGGAAGTTGAATCTACTTCTCTCAGAGTAGCAAATCAAAAATCTTGTCAGCCTTGGTAATATCAAAGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.40%	10.80%	12.38%	45.47%	NA
All Indica	2759	20.00%	11.90%	17.94%	50.09%	NA
All Japonica	1512	51.90%	10.50%	0.93%	36.71%	NA
Aus	269	41.30%	1.90%	22.30%	34.57%	NA
Indica I	595	16.10%	4.70%	13.11%	66.05%	NA
Indica II	465	16.10%	10.10%	22.58%	51.18%	NA
Indica III	913	23.30%	17.10%	18.07%	41.51%	NA
Indica Intermediate	786	21.50%	12.50%	18.70%	47.33%	NA
Temperate Japonica	767	85.90%	0.70%	0.78%	12.65%	NA
Tropical Japonica	504	9.50%	27.20%	1.39%	61.90%	NA
Japonica Intermediate	241	32.00%	7.10%	0.41%	60.58%	NA
VI/Aromatic	96	6.20%	8.30%	5.21%	80.21%	NA
Intermediate	90	31.10%	10.00%	12.22%	46.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0811931786	G -> A	LOC_Os08g19910.1	upstream_gene_variant ; 4055.0bp to feature; MODIFIER	silent_mutation	Average:13.761; most accessible tissue: Callus, score: 27.175	N	N	N	N
vg0811931786	G -> A	LOC_Os08g19930.1	upstream_gene_variant ; 3472.0bp to feature; MODIFIER	silent_mutation	Average:13.761; most accessible tissue: Callus, score: 27.175	N	N	N	N
vg0811931786	G -> A	LOC_Os08g19920.1	intron_variant ; MODIFIER	silent_mutation	Average:13.761; most accessible tissue: Callus, score: 27.175	N	N	N	N
vg0811931786	G -> DEL	N	N	silent_mutation	Average:13.761; most accessible tissue: Callus, score: 27.175	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0811931786	NA	9.03E-06	mr1134	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811931786	3.75E-06	NA	mr1275	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811931786	NA	1.15E-06	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251