Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0811907190:

Variant ID: vg0811907190 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 11907190
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

AGCAAGGTCAATAGTGTAGCCAGCTACTAGCTCCAATAATATCCATGTCATTTTATAGCCAATATCAAAACTAACTAGTACAATAGGTTGGCTATTATAT[C/T]
AACATGATCTCATTATTCAAACAATAAACTTTACATGTGCATGATCAGAAACGCCCTCAACTCTGTGGCCTATATGGCCATTTGTATTATGCAATAAACA

Reverse complement sequence

TGTTTATTGCATAATACAAATGGCCATATAGGCCACAGAGTTGAGGGCGTTTCTGATCATGCACATGTAAAGTTTATTGTTTGAATAATGAGATCATGTT[G/A]
ATATAATAGCCAACCTATTGTACTAGTTAGTTTTGATATTGGCTATAAAATGACATGGATATTATTGGAGCTAGTAGCTGGCTACACTATTGACCTTGCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.20%	8.50%	7.55%	1.71%	NA
All Indica	2759	79.20%	8.60%	9.39%	2.75%	NA
All Japonica	1512	85.60%	9.60%	4.76%	0.07%	NA
Aus	269	89.60%	2.60%	6.69%	1.12%	NA
Indica I	595	88.10%	2.00%	7.56%	2.35%	NA
Indica II	465	87.30%	4.90%	6.88%	0.86%	NA
Indica III	913	67.00%	15.20%	13.14%	4.60%	NA
Indica Intermediate	786	81.90%	8.10%	7.89%	2.04%	NA
Temperate Japonica	767	97.50%	0.30%	2.22%	0.00%	NA
Tropical Japonica	504	65.50%	25.40%	9.13%	0.00%	NA
Japonica Intermediate	241	89.60%	6.20%	3.73%	0.41%	NA
VI/Aromatic	96	90.60%	7.30%	1.04%	1.04%	NA
Intermediate	90	87.80%	4.40%	7.78%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0811907190	C -> T	LOC_Os08g19870.1	upstream_gene_variant ; 398.0bp to feature; MODIFIER	silent_mutation	Average:60.129; most accessible tissue: Zhenshan97 root, score: 78.34	N	N	N	N
vg0811907190	C -> T	LOC_Os08g19880.1	upstream_gene_variant ; 2606.0bp to feature; MODIFIER	silent_mutation	Average:60.129; most accessible tissue: Zhenshan97 root, score: 78.34	N	N	N	N
vg0811907190	C -> T	LOC_Os08g19860.1	downstream_gene_variant ; 3614.0bp to feature; MODIFIER	silent_mutation	Average:60.129; most accessible tissue: Zhenshan97 root, score: 78.34	N	N	N	N
vg0811907190	C -> T	LOC_Os08g19890.1	downstream_gene_variant ; 4303.0bp to feature; MODIFIER	silent_mutation	Average:60.129; most accessible tissue: Zhenshan97 root, score: 78.34	N	N	N	N
vg0811907190	C -> T	LOC_Os08g19870-LOC_Os08g19880	intergenic_region ; MODIFIER	silent_mutation	Average:60.129; most accessible tissue: Zhenshan97 root, score: 78.34	N	N	N	N
vg0811907190	C -> DEL	N	N	silent_mutation	Average:60.129; most accessible tissue: Zhenshan97 root, score: 78.34	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0811907190	NA	1.11E-06	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811907190	NA	7.50E-06	mr1309	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811907190	3.97E-06	1.50E-06	mr1817	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811907190	NA	7.24E-06	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811907190	NA	1.55E-07	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251