Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0811767202:

Variant ID: vg0811767202 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 11767202
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCGGGCAGTCCCCTCTCATGCCTAGGTGAATCCGGAAGCCGCATAGGCCATCGCAGGGCCCATCCAAACTCCATCACGCCCACCCTTGCCTGGATGCGTC[G/A]
GCTAGAGGAAAGCTACACTACAAGCCCAGTCATTGCCCACGCTGGCTTATGGTAAATACGAGGAATTCTTCCAGGGTTTCCCGCGAAGCAGTCCTTAATT

Reverse complement sequence

AATTAAGGACTGCTTCGCGGGAAACCCTGGAAGAATTCCTCGTATTTACCATAAGCCAGCGTGGGCAATGACTGGGCTTGTAGTGTAGCTTTCCTCTAGC[C/T]
GACGCATCCAGGCAAGGGTGGGCGTGATGGAGTTTGGATGGGCCCTGCGATGGCCTATGCGGCTTCCGGATTCACCTAGGCATGAGAGGGGACTGCCCGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.40%	3.70%	16.72%	35.15%	NA
All Indica	2759	19.50%	0.30%	22.83%	57.30%	NA
All Japonica	1512	83.90%	10.30%	4.17%	1.72%	NA
Aus	269	57.20%	0.00%	30.11%	12.64%	NA
Indica I	595	11.40%	0.00%	25.71%	62.86%	NA
Indica II	465	22.40%	0.20%	22.80%	54.62%	NA
Indica III	913	22.50%	0.40%	18.62%	58.49%	NA
Indica Intermediate	786	20.60%	0.50%	25.57%	53.31%	NA
Temperate Japonica	767	95.40%	0.30%	2.22%	2.09%	NA
Tropical Japonica	504	67.30%	27.00%	4.96%	0.79%	NA
Japonica Intermediate	241	81.70%	7.10%	8.71%	2.49%	NA
VI/Aromatic	96	89.60%	7.30%	1.04%	2.08%	NA
Intermediate	90	56.70%	6.70%	16.67%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0811767202	G -> A	LOC_Os08g19650.1	downstream_gene_variant ; 1936.0bp to feature; MODIFIER	silent_mutation	Average:42.271; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg0811767202	G -> A	LOC_Os08g19660.1	downstream_gene_variant ; 3139.0bp to feature; MODIFIER	silent_mutation	Average:42.271; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg0811767202	G -> A	LOC_Os08g19650.2	downstream_gene_variant ; 1936.0bp to feature; MODIFIER	silent_mutation	Average:42.271; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg0811767202	G -> A	LOC_Os08g19650-LOC_Os08g19660	intergenic_region ; MODIFIER	silent_mutation	Average:42.271; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg0811767202	G -> DEL	N	N	silent_mutation	Average:42.271; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0811767202	NA	8.02E-08	mr1134	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811767202	NA	3.19E-07	mr1135	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811767202	NA	2.51E-07	mr1504	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811767202	NA	6.93E-07	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811767202	1.27E-06	2.16E-07	mr1835	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811767202	2.90E-06	2.90E-06	mr1541_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811767202	NA	2.32E-06	mr1638_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0811767202	NA	1.16E-06	mr1929_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251