Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0810997379:

Variant ID: vg0810997379 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 10997379
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

TAATCGATTAGCCGTGCTCACGGTCATGAGCGCTTTGGTGATGTGTCATGAGTATAGACTATGTTTTAAAAATGTGATCATGTGATATTGGTTTGAAATT[A/G]
ATAAATGTGTTGAGTTGTGTGTGTGAGGTGATATATTATGTCTTGTTGTCAAAGGATGACAACAGGAGATTGATTATAATGGAATTATGATGAATTAAAT

Reverse complement sequence

ATTTAATTCATCATAATTCCATTATAATCAATCTCCTGTTGTCATCCTTTGACAACAAGACATAATATATCACCTCACACACACAACTCAACACATTTAT[T/C]
AATTTCAAACCAATATCACATGATCACATTTTTAAAACATAGTCTATACTCATGACACATCACCAAAGCGCTCATGACCGTGAGCACGGCTAATCGATTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	19.00%	14.20%	27.63%	39.17%	NA
All Indica	2759	1.70%	7.70%	33.09%	57.56%	NA
All Japonica	1512	54.80%	14.50%	16.47%	14.22%	NA
Aus	269	0.70%	63.90%	30.86%	4.46%	NA
Indica I	595	1.00%	2.70%	19.16%	77.14%	NA
Indica II	465	2.40%	2.20%	25.81%	69.68%	NA
Indica III	913	1.30%	13.60%	43.59%	41.51%	NA
Indica Intermediate	786	2.20%	7.90%	35.75%	54.20%	NA
Temperate Japonica	767	92.70%	1.70%	3.00%	2.61%	NA
Tropical Japonica	504	8.70%	31.30%	33.73%	26.19%	NA
Japonica Intermediate	241	30.70%	19.90%	23.24%	26.14%	NA
VI/Aromatic	96	0.00%	55.20%	38.54%	6.25%	NA
Intermediate	90	22.20%	17.80%	26.67%	33.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0810997379	A -> G	LOC_Os08g17920.1	upstream_gene_variant ; 3549.0bp to feature; MODIFIER	silent_mutation	Average:9.539; most accessible tissue: Callus, score: 17.168	N	N	N	N
vg0810997379	A -> G	LOC_Os08g17930.1	upstream_gene_variant ; 964.0bp to feature; MODIFIER	silent_mutation	Average:9.539; most accessible tissue: Callus, score: 17.168	N	N	N	N
vg0810997379	A -> G	LOC_Os08g17920-LOC_Os08g17930	intergenic_region ; MODIFIER	silent_mutation	Average:9.539; most accessible tissue: Callus, score: 17.168	N	N	N	N
vg0810997379	A -> DEL	N	N	silent_mutation	Average:9.539; most accessible tissue: Callus, score: 17.168	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0810997379	NA	5.86E-07	mr1129	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810997379	NA	1.61E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810997379	NA	2.37E-06	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810997379	NA	5.11E-06	mr1672	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810997379	NA	8.48E-06	mr1689	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810997379	1.47E-06	NA	mr1335_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810997379	NA	2.02E-21	mr1361_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810997379	NA	9.72E-06	mr1672_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251