Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0810889885:

Variant ID: vg0810889885 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 10889885
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAATTTTATAATACTAAATGAGCTCATAAGAAAAAATTGTTAAAAACAAAGTTGTAGAACACATTGAGATCTACTAATTTTATTTTGGTCATTTATCCAT[C/T]
CGAGTTTGATTGAACTATATAAAATTTGAATTTTAAAATATAAGAAATTCAAATAATTTTTCCATGTAGTAAATGATTTCAAATGGAAAAATTATCAAAA

Reverse complement sequence

TTTTGATAATTTTTCCATTTGAAATCATTTACTACATGGAAAAATTATTTGAATTTCTTATATTTTAAAATTCAAATTTTATATAGTTCAATCAAACTCG[G/A]
ATGGATAAATGACCAAAATAAAATTAGTAGATCTCAATGTGTTCTACAACTTTGTTTTTAACAATTTTTTCTTATGAGCTCATTTAGTATTATAAAATTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.20% 4.70% 0.02% 0.00% NA
All Indica  2759 96.70% 3.30% 0.00% 0.00% NA
All Japonica  1512 91.70% 8.20% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 91.20% 8.80% 0.00% 0.00% NA
Indica Intermediate  786 99.00% 1.00% 0.00% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 78.40% 21.40% 0.20% 0.00% NA
Japonica Intermediate  241 94.60% 5.40% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0810889885 C -> T LOC_Os08g17770.1 downstream_gene_variant ; 3966.0bp to feature; MODIFIER silent_mutation Average:29.677; most accessible tissue: Zhenshan97 flower, score: 52.192 N N N N
vg0810889885 C -> T LOC_Os08g17760-LOC_Os08g17770 intergenic_region ; MODIFIER silent_mutation Average:29.677; most accessible tissue: Zhenshan97 flower, score: 52.192 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0810889885 NA 7.97E-06 mr1504 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810889885 4.55E-06 NA mr1085_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810889885 NA 2.30E-06 mr1149_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810889885 NA 5.64E-07 mr1200_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810889885 NA 3.31E-06 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810889885 5.78E-06 9.58E-06 mr1595_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810889885 1.29E-06 NA mr1949_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251