RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0810860589:

Variant ID: vg0810860589 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 10860589
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:

ATGTTGAACCATTAAAACACCTTGTCAATGTATGTACTCTGGCTTAATCCAATTAGCCTCTTTGATGTATCTCTATAGATCCTTATGCCCAGAATATATG[C/T]
TGTTTCCCCTAAGTCCTTCATTGAAAAACTATTTTTCAACGATGTCTTAACGGATTCAAGCATAGGAATATCGTTCCCAATCAATAATATGTCATCTACA

Reverse complement sequence

TGTAGATGACATATTATTGATTGGGAACGATATTCCTATGCTTGAATCCGTTAAGACATCGTTGAAAAATAGTTTTTCAATGAAGGACTTAGGGGAAACA[G/A]
CATATATTCTGGGCATAAGGATCTATAGAGATACATCAAAGAGGCTAATTGGATTAAGCCAGAGTACATACATTGACAAGGTGTTTTAATGGTTCAACAT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.00%	1.00%	3.91%	7.11%	NA
All Indica	2759	99.90%	0.00%	0.07%	0.04%	NA
All Japonica	1512	67.30%	3.10%	10.52%	19.11%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.00%	0.00%	0.22%	NA
Indica III	913	99.90%	0.00%	0.11%	0.00%	NA
Indica Intermediate	786	99.90%	0.00%	0.13%	0.00%	NA
Temperate Japonica	767	91.40%	4.30%	2.74%	1.56%	NA
Tropical Japonica	504	41.90%	0.20%	17.66%	40.28%	NA
Japonica Intermediate	241	43.60%	5.40%	20.33%	30.71%	NA
VI/Aromatic	96	39.60%	0.00%	20.83%	39.58%	NA
Intermediate	90	85.60%	1.10%	4.44%	8.89%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0810860589	C -> T	LOC_Os08g17750.1	missense_variant ; p.Ala1135Thr; MODERATE	nonsynonymous_codon ; A1135T	Average:26.722; most accessible tissue: Zhenshan97 flag leaf, score: 36.135	benign	0.117	TOLERATED	0.17
vg0810860589	C -> DEL	LOC_Os08g17750.1	N	frameshift_variant	Average:26.722; most accessible tissue: Zhenshan97 flag leaf, score: 36.135	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0810860589	NA	7.11E-17	Grain_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0810860589	NA	2.15E-12	Grain_weight	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0810860589	NA	2.80E-08	Grain_weight	Jap_All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0810860589	NA	8.52E-12	mr1084	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810860589	NA	3.41E-06	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810860589	NA	2.72E-13	mr1205	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810860589	NA	7.65E-06	mr1205	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810860589	NA	7.79E-06	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810860589	NA	1.75E-06	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810860589	NA	3.44E-07	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 19 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0810860589:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact