Variant ID: vg0810833095 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 10833095 |
Reference Allele: A | Alternative Allele: T |
Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 404. )
GCACACCATTCCCTCCTGACCTTCTAGTACATACCCATCTGGTTGATCCATATAGATCTCCTCCTCCAACTCTCCATTGAGGAAAGCTGTCTTAACATCC[A/T]
TCTGATGGACGAGTAGACCATGAGAGACTGCCAGAGTGAGTAGTACTCGAATCGTGGTCAAGCGAGCAACCGGTGAATAAGTGTCGAAAAAATCCTCGCC
GGCGAGGATTTTTTCGACACTTATTCACCGGTTGCTCGCTTGACCACGATTCGAGTACTACTCACTCTGGCAGTCTCTCATGGTCTACTCGTCCATCAGA[T/A]
GGATGTTAAGACAGCTTTCCTCAATGGAGAGTTGGAGGAGGAGATCTATATGGATCAACCAGATGGGTATGTACTAGAAGGTCAGGAGGGAATGGTGTGC
Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 88.40% | 11.60% | 0.06% | 0.00% | NA |
All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 70.00% | 29.80% | 0.13% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 37.50% | 62.10% | 0.40% | 0.00% | NA |
Japonica Intermediate | 241 | 49.80% | 50.20% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 21.90% | 78.10% | 0.00% | 0.00% | NA |
Intermediate | 90 | 77.80% | 21.10% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0810833095 | A -> T | LOC_Os08g17700.1 | missense_variant ; p.Met812Lys; MODERATE | nonsynonymous_codon ; M812K | Average:35.593; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 | benign | 0.848 | DELETERIOUS | 0.00 |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0810833095 | NA | 1.51E-06 | mr1206 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0810833095 | NA | 1.79E-09 | mr1332 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0810833095 | NA | 8.75E-12 | mr1454 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0810833095 | NA | 4.60E-12 | mr1521 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0810833095 | NA | 4.68E-08 | mr1851 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0810833095 | 3.87E-06 | NA | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0810833095 | 6.20E-06 | NA | mr1104_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0810833095 | NA | 2.67E-08 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0810833095 | NA | 5.48E-07 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0810833095 | NA | 5.12E-09 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |