Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0810533736:

Variant ID: vg0810533736 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 10533736
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

AAAGATAAAAGGAAAACATAAAGTCCTTATCGGACACTAAACACACTTTTCTAAAGATAAAAGGAAACTAACAAACTATTCCTAATTAATAGATAAACTG[C/T]
CATGCCGCATCCTCTTTAAACTCGGTCACTTAGGGATAAGCTTCCTTTAGTAGATTGATTTCCTTAACCGAATATAGCAGGAATCCGACTATTGGCGACT

Reverse complement sequence

AGTCGCCAATAGTCGGATTCCTGCTATATTCGGTTAAGGAAATCAATCTACTAAAGGAAGCTTATCCCTAAGTGACCGAGTTTAAAGAGGATGCGGCATG[G/A]
CAGTTTATCTATTAATTAGGAATAGTTTGTTAGTTTCCTTTTATCTTTAGAAAAGTGTGTTTAGTGTCCGATAAGGACTTTATGTTTTCCTTTTATCTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.90%	3.20%	0.25%	13.69%	NA
All Indica	2759	96.50%	0.60%	0.36%	2.57%	NA
All Japonica	1512	59.80%	8.20%	0.13%	31.88%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	97.00%	2.60%	0.00%	0.43%	NA
Indica III	913	92.20%	0.00%	0.88%	6.90%	NA
Indica Intermediate	786	98.50%	0.50%	0.25%	0.76%	NA
Temperate Japonica	767	91.70%	0.30%	0.00%	8.08%	NA
Tropical Japonica	504	19.00%	21.60%	0.40%	58.93%	NA
Japonica Intermediate	241	43.60%	5.40%	0.00%	51.04%	NA
VI/Aromatic	96	13.50%	6.20%	0.00%	80.21%	NA
Intermediate	90	75.60%	5.60%	0.00%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0810533736	C -> T	LOC_Os08g17180.1	downstream_gene_variant ; 4705.0bp to feature; MODIFIER	silent_mutation	Average:54.608; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0810533736	C -> T	LOC_Os08g17180-LOC_Os08g17210	intergenic_region ; MODIFIER	silent_mutation	Average:54.608; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N
vg0810533736	C -> DEL	N	N	silent_mutation	Average:54.608; most accessible tissue: Minghui63 flag leaf, score: 70.648	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0810533736	NA	1.77E-06	mr1134	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810533736	NA	1.15E-06	mr1504	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810533736	NA	1.42E-06	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810533736	5.35E-06	NA	mr1085_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810533736	8.60E-06	1.00E-06	mr1149_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810533736	NA	3.53E-06	mr1200_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810533736	5.86E-06	4.99E-07	mr1441_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810533736	1.82E-06	4.23E-06	mr1595_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810533736	1.67E-06	NA	mr1600_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810533736	NA	7.07E-07	mr1855_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251