Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0810074467:

Variant ID: vg0810074467 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 10074467
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

GGAGATAGTTGTGATTGATTGAGATGAAGGGATAGCTGGAGAAATAGCTATATTTTTGGACAAATTTAAACTCTATGAATAGCTACATTTTAGGACTGAG[G/A]
GAATACGTAACATACATAATCATTATAAAAACATAAATACTAAAATCACCTTAGATCAAAATCTTCACAACTTAAACTCATCAATGAAATTCTTTGCTAC

Reverse complement sequence

GTAGCAAAGAATTTCATTGATGAGTTTAAGTTGTGAAGATTTTGATCTAAGGTGATTTTAGTATTTATGTTTTTATAATGATTATGTATGTTACGTATTC[C/T]
CTCAGTCCTAAAATGTAGCTATTCATAGAGTTTAAATTTGTCCAAAAATATAGCTATTTCTCCAGCTATCCCTTCATCTCAATCAATCACAACTATCTCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.90%	14.00%	1.57%	16.53%	NA
All Indica	2759	76.20%	18.70%	0.54%	4.49%	NA
All Japonica	1512	58.90%	0.20%	3.70%	37.24%	NA
Aus	269	51.30%	48.70%	0.00%	0.00%	NA
Indica I	595	62.40%	37.30%	0.34%	0.00%	NA
Indica II	465	82.20%	4.10%	0.86%	12.90%	NA
Indica III	913	78.30%	17.10%	0.44%	4.16%	NA
Indica Intermediate	786	80.80%	15.30%	0.64%	3.31%	NA
Temperate Japonica	767	91.50%	0.10%	6.00%	2.35%	NA
Tropical Japonica	504	16.70%	0.00%	1.19%	82.14%	NA
Japonica Intermediate	241	43.20%	0.80%	1.66%	54.36%	NA
VI/Aromatic	96	15.60%	4.20%	2.08%	78.12%	NA
Intermediate	90	70.00%	7.80%	1.11%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0810074467	G -> A	LOC_Os08g16440.1	upstream_gene_variant ; 4524.0bp to feature; MODIFIER	silent_mutation	Average:33.71; most accessible tissue: Callus, score: 69.849	N	N	N	N
vg0810074467	G -> A	LOC_Os08g16460.1	upstream_gene_variant ; 2957.0bp to feature; MODIFIER	silent_mutation	Average:33.71; most accessible tissue: Callus, score: 69.849	N	N	N	N
vg0810074467	G -> A	LOC_Os08g16450.1	downstream_gene_variant ; 2275.0bp to feature; MODIFIER	silent_mutation	Average:33.71; most accessible tissue: Callus, score: 69.849	N	N	N	N
vg0810074467	G -> A	LOC_Os08g16450-LOC_Os08g16460	intergenic_region ; MODIFIER	silent_mutation	Average:33.71; most accessible tissue: Callus, score: 69.849	N	N	N	N
vg0810074467	G -> DEL	N	N	silent_mutation	Average:33.71; most accessible tissue: Callus, score: 69.849	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0810074467	4.05E-06	4.05E-06	mr1212	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810074467	NA	6.78E-06	mr1222	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810074467	NA	1.11E-06	mr1277	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810074467	NA	2.97E-06	mr1689	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810074467	NA	6.58E-10	mr1156_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810074467	NA	8.61E-08	mr1277_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810074467	NA	1.12E-06	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810074467	3.02E-07	8.54E-14	mr1993_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251