Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0809442889:

Variant ID: vg0809442889 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 9442889
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, G: 0.00, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:

TCATGTATACAACATATATAGCATATGGAGGAACAAAATCGGTTCATGTACACAAAAATTTCGATGTTCATTACAGCTGAAAGTACTCACACGATAAATA[T/G]
ACCATATGATGGAAATATACCTGTAAGAGGTGTGTTGCAGAGGTGCAACACAGTAGACATCAAAGCTTAATTGTTCCTGAAATAAAACATATAGAAGGGT

Reverse complement sequence

ACCCTTCTATATGTTTTATTTCAGGAACAATTAAGCTTTGATGTCTACTGTGTTGCACCTCTGCAACACACCTCTTACAGGTATATTTCCATCATATGGT[A/C]
TATTTATCGTGTGAGTACTTTCAGCTGTAATGAACATCGAAATTTTTGTGTACATGAACCGATTTTGTTCCTCCATATGCTATATATGTTGTATACATGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.50%	4.10%	3.81%	17.56%	NA
All Indica	2759	92.10%	1.70%	5.33%	0.80%	NA
All Japonica	1512	43.80%	7.00%	1.65%	47.55%	NA
Aus	269	76.20%	13.00%	1.49%	9.29%	NA
Indica I	595	96.00%	0.50%	3.36%	0.17%	NA
Indica II	465	91.60%	3.20%	2.15%	3.01%	NA
Indica III	913	90.50%	1.80%	7.78%	0.00%	NA
Indica Intermediate	786	91.50%	1.80%	5.85%	0.89%	NA
Temperate Japonica	767	63.80%	0.30%	0.78%	35.20%	NA
Tropical Japonica	504	15.90%	19.60%	3.57%	60.91%	NA
Japonica Intermediate	241	38.60%	2.10%	0.41%	58.92%	NA
VI/Aromatic	96	39.60%	2.10%	2.08%	56.25%	NA
Intermediate	90	81.10%	5.60%	2.22%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0809442889	T -> G	LOC_Os08g15530.1	downstream_gene_variant ; 2211.0bp to feature; MODIFIER	silent_mutation	Average:15.042; most accessible tissue: Minghui63 root, score: 25.504	N	N	N	N
vg0809442889	T -> G	LOC_Os08g15510-LOC_Os08g15530	intergenic_region ; MODIFIER	silent_mutation	Average:15.042; most accessible tissue: Minghui63 root, score: 25.504	N	N	N	N
vg0809442889	T -> DEL	N	N	silent_mutation	Average:15.042; most accessible tissue: Minghui63 root, score: 25.504	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0809442889	1.95E-07	1.51E-09	mr1076	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809442889	NA	8.13E-08	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809442889	NA	2.59E-08	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809442889	NA	1.08E-06	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809442889	8.25E-07	2.49E-09	mr1227	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809442889	NA	1.10E-06	mr1408	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809442889	NA	4.88E-06	mr1560	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809442889	NA	7.87E-09	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809442889	NA	2.60E-06	mr1850_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809442889	7.30E-08	4.09E-09	mr1929_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251