Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808474802:

Variant ID: vg0808474802 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 8474802
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

ACGAAAACGACCGGATATGATTCAAAACTAAGATTCCCCTTAGTAAAATAATATTACCTCCGTCCCAAAATAAGTGCAGCCGTGGATATCCGTGTCCAAC[G/A]
TTTGACCGTATGTCTTATTTGAAAATTTTGAAAATATTTAGTCACACATAAAATATTATTCATATTTTATCATCTAATAGCAATAAAAATACTAATTATA

Reverse complement sequence

TATAATTAGTATTTTTATTGCTATTAGATGATAAAATATGAATAATATTTTATGTGTGACTAAATATTTTCAAAATTTTCAAATAAGACATACGGTCAAA[C/T]
GTTGGACACGGATATCCACGGCTGCACTTATTTTGGGACGGAGGTAATATTATTTTACTAAGGGGAATCTTAGTTTTGAATCATATCCGGTCGTTTTCGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.90%	6.90%	0.36%	2.90%	NA
All Indica	2759	83.00%	11.70%	0.47%	4.82%	NA
All Japonica	1512	99.90%	0.00%	0.00%	0.07%	NA
Aus	269	98.90%	0.00%	0.74%	0.37%	NA
Indica I	595	66.10%	33.80%	0.17%	0.00%	NA
Indica II	465	67.70%	7.30%	1.29%	23.66%	NA
Indica III	913	99.30%	0.40%	0.11%	0.11%	NA
Indica Intermediate	786	86.00%	10.60%	0.64%	2.80%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	94.40%	2.20%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0808474802	G -> A	LOC_Os08g14195.1	upstream_gene_variant ; 4559.0bp to feature; MODIFIER	silent_mutation	Average:24.247; most accessible tissue: Callus, score: 54.385	N	N	N	N
vg0808474802	G -> A	LOC_Os08g14190.1	intron_variant ; MODIFIER	silent_mutation	Average:24.247; most accessible tissue: Callus, score: 54.385	N	N	N	N
vg0808474802	G -> DEL	N	N	silent_mutation	Average:24.247; most accessible tissue: Callus, score: 54.385	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0808474802	NA	3.47E-06	mr1038	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808474802	NA	1.55E-06	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808474802	NA	3.06E-07	mr1389	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808474802	NA	1.25E-06	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808474802	NA	1.88E-06	mr1038_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808474802	NA	3.98E-06	mr1125_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808474802	NA	3.34E-06	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808474802	3.34E-06	3.34E-06	mr1615_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251