Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808453559:

Variant ID: vg0808453559 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 8453559
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTGGAAGTTGTGGGAGAGACGCTACATCACTGGTCGAGGACCAGGCAGTAGCCGTAACTCGACCACTGAAAGTGGAAGTAGTCGGAGGAACGCTACATCG[C/T]
TGGTCGAGGACCAGGCAGTAGCCGTAACTCGACCACTGAAAGCAGAAGTGGTGGGAGAAAAGCTACGTCGCTAGTCGAGGACCAGGCAGTAGTCGTAACT

Reverse complement sequence

AGTTACGACTACTGCCTGGTCCTCGACTAGCGACGTAGCTTTTCTCCCACCACTTCTGCTTTCAGTGGTCGAGTTACGGCTACTGCCTGGTCCTCGACCA[G/A]
CGATGTAGCGTTCCTCCGACTACTTCCACTTTCAGTGGTCGAGTTACGGCTACTGCCTGGTCCTCGACCAGTGATGTAGCGTCTCTCCCACAACTTCCAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.40%	16.90%	1.48%	1.18%	NA
All Indica	2759	70.80%	24.70%	2.46%	2.03%	NA
All Japonica	1512	99.50%	0.30%	0.13%	0.00%	NA
Aus	269	64.70%	35.30%	0.00%	0.00%	NA
Indica I	595	69.60%	17.80%	5.38%	7.23%	NA
Indica II	465	88.20%	5.40%	6.24%	0.22%	NA
Indica III	913	59.50%	40.50%	0.00%	0.00%	NA
Indica Intermediate	786	74.60%	23.00%	0.89%	1.53%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.40%	0.40%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0808453559	C -> T	LOC_Os08g14140.1	upstream_gene_variant ; 1645.0bp to feature; MODIFIER	silent_mutation	Average:15.339; most accessible tissue: Callus, score: 45.456	N	N	N	N
vg0808453559	C -> T	LOC_Os08g14130.1	downstream_gene_variant ; 3890.0bp to feature; MODIFIER	silent_mutation	Average:15.339; most accessible tissue: Callus, score: 45.456	N	N	N	N
vg0808453559	C -> T	LOC_Os08g14150.1	downstream_gene_variant ; 1482.0bp to feature; MODIFIER	silent_mutation	Average:15.339; most accessible tissue: Callus, score: 45.456	N	N	N	N
vg0808453559	C -> T	LOC_Os08g14160.1	downstream_gene_variant ; 2242.0bp to feature; MODIFIER	silent_mutation	Average:15.339; most accessible tissue: Callus, score: 45.456	N	N	N	N
vg0808453559	C -> T	LOC_Os08g14140-LOC_Os08g14150	intergenic_region ; MODIFIER	silent_mutation	Average:15.339; most accessible tissue: Callus, score: 45.456	N	N	N	N
vg0808453559	C -> DEL	N	N	silent_mutation	Average:15.339; most accessible tissue: Callus, score: 45.456	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0808453559	NA	1.32E-07	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808453559	NA	2.15E-06	mr1116	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808453559	8.25E-07	8.25E-07	mr1374	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808453559	NA	8.41E-08	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808453559	NA	4.39E-06	mr1510	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808453559	5.44E-06	NA	mr1515	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808453559	8.78E-06	8.78E-06	mr1687	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808453559	4.94E-06	8.85E-06	mr1759	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808453559	NA	1.94E-06	mr1844	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808453559	5.49E-06	5.49E-06	mr1884	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251