| Variant ID: vg0808373173 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 8373173 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGCGCGCAGCACGCGAGCGAAGAGGAAGACGAGCCGTCGCAAACGAACAGAGAGCAGTCGCGCAAAGCGCTTCCCAAAAACCATATTATCGCCTTCTCCC[G/A]
GTGCAGGACGTCGAAGGCAGAGGTTCCAGAGACCTGCTCTCTCGATCGCCGGTGCAAGCCGGCGAGTGGGATGGAGTAGTCTACGAGCGACAGTGCGGCA
TGCCGCACTGTCGCTCGTAGACTACTCCATCCCACTCGCCGGCTTGCACCGGCGATCGAGAGAGCAGGTCTCTGGAACCTCTGCCTTCGACGTCCTGCAC[C/T]
GGGAGAAGGCGATAATATGGTTTTTGGGAAGCGCTTTGCGCGACTGCTCTCTGTTCGTTTGCGACGGCTCGTCTTCCTCTTCGCTCGCGTGCTGCGCGCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.00% | 4.50% | 6.09% | 47.42% | NA |
| All Indica | 2759 | 28.50% | 0.20% | 9.60% | 61.73% | NA |
| All Japonica | 1512 | 74.10% | 13.60% | 0.86% | 11.44% | NA |
| Aus | 269 | 7.10% | 0.00% | 2.23% | 90.71% | NA |
| Indica I | 595 | 20.50% | 0.00% | 5.38% | 74.12% | NA |
| Indica II | 465 | 64.70% | 0.60% | 5.59% | 29.03% | NA |
| Indica III | 913 | 12.30% | 0.10% | 15.12% | 72.51% | NA |
| Indica Intermediate | 786 | 31.80% | 0.30% | 8.78% | 59.16% | NA |
| Temperate Japonica | 767 | 97.70% | 0.70% | 0.39% | 1.30% | NA |
| Tropical Japonica | 504 | 40.10% | 36.50% | 1.39% | 22.02% | NA |
| Japonica Intermediate | 241 | 70.50% | 6.60% | 1.24% | 21.58% | NA |
| VI/Aromatic | 96 | 12.50% | 0.00% | 1.04% | 86.46% | NA |
| Intermediate | 90 | 51.10% | 3.30% | 3.33% | 42.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0808373173 | G -> A | LOC_Os08g13960.1 | upstream_gene_variant ; 355.0bp to feature; MODIFIER | silent_mutation | Average:30.276; most accessible tissue: Minghui63 flag leaf, score: 72.028 | N | N | N | N |
| vg0808373173 | G -> A | LOC_Os08g13970.1 | downstream_gene_variant ; 2474.0bp to feature; MODIFIER | silent_mutation | Average:30.276; most accessible tissue: Minghui63 flag leaf, score: 72.028 | N | N | N | N |
| vg0808373173 | G -> A | LOC_Os08g13960-LOC_Os08g13970 | intergenic_region ; MODIFIER | silent_mutation | Average:30.276; most accessible tissue: Minghui63 flag leaf, score: 72.028 | N | N | N | N |
| vg0808373173 | G -> DEL | N | N | silent_mutation | Average:30.276; most accessible tissue: Minghui63 flag leaf, score: 72.028 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0808373173 | NA | 1.81E-06 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808373173 | NA | 9.88E-07 | mr1518 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808373173 | 5.61E-06 | 1.67E-10 | mr1676 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808373173 | NA | 2.51E-08 | mr1498_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808373173 | NA | 3.57E-09 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |