| Variant ID: vg0808245241 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 8245241 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GAATGGAGGCTTTCAACAAGTTTGTGAATGATTTTGGACTGCAAGAATTTTACAGAACTGGGGGGAAGTTCACCTGGACTAACAATCAGCTGCAGCCTGT[C/T]
AGAGTTGTTTTGGACAGAGTTTTAGCTTCTGAGAACTGGGAGAAAAAATTCCCGCTTACTTATGTGACCTCTCTGCTTAGAGTAGGTTCTGATCACACAG
CTGTGTGATCAGAACCTACTCTAAGCAGAGAGGTCACATAAGTAAGCGGGAATTTTTTCTCCCAGTTCTCAGAAGCTAAAACTCTGTCCAAAACAACTCT[G/A]
ACAGGCTGCAGCTGATTGTTAGTCCAGGTGAACTTCCCCCCAGTTCTGTAAAATTCTTGCAGTCCAAAATCATTCACAAACTTGTTGAAAGCCTCCATTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 30.50% | 0.60% | 0.91% | 68.01% | NA |
| All Indica | 2759 | 4.50% | 0.00% | 1.23% | 94.24% | NA |
| All Japonica | 1512 | 80.00% | 1.90% | 0.46% | 17.59% | NA |
| Aus | 269 | 1.50% | 0.00% | 0.74% | 97.77% | NA |
| Indica I | 595 | 7.40% | 0.00% | 1.51% | 91.09% | NA |
| Indica II | 465 | 4.30% | 0.00% | 1.29% | 94.41% | NA |
| Indica III | 913 | 1.60% | 0.00% | 1.20% | 97.15% | NA |
| Indica Intermediate | 786 | 5.90% | 0.00% | 1.02% | 93.13% | NA |
| Temperate Japonica | 767 | 89.40% | 3.80% | 0.78% | 6.00% | NA |
| Tropical Japonica | 504 | 75.80% | 0.00% | 0.20% | 24.01% | NA |
| Japonica Intermediate | 241 | 58.90% | 0.00% | 0.00% | 41.08% | NA |
| VI/Aromatic | 96 | 74.00% | 0.00% | 0.00% | 26.04% | NA |
| Intermediate | 90 | 33.30% | 0.00% | 0.00% | 66.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0808245241 | C -> T | LOC_Os08g13810.1 | synonymous_variant ; p.Val406Val; LOW | synonymous_codon | Average:11.473; most accessible tissue: Callus, score: 62.675 | N | N | N | N |
| vg0808245241 | C -> DEL | LOC_Os08g13810.1 | N | frameshift_variant | Average:11.473; most accessible tissue: Callus, score: 62.675 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0808245241 | NA | 6.85E-11 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0808245241 | NA | 1.84E-06 | mr1201 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808245241 | 2.87E-06 | 6.89E-07 | mr1219 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808245241 | NA | 3.92E-06 | mr1274 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808245241 | NA | 7.42E-06 | mr1201_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808245241 | 3.90E-06 | 2.08E-06 | mr1219_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808245241 | 6.65E-07 | 7.16E-08 | mr1274_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |