Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808210049:

Variant ID: vg0808210049 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 8210049
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:

CCGGAAACTCGCCTCGTCGCCATCTTGTGCATGCATGATGATCTGAACAGAAAGAGAAGGAAAACAAAAGAAAACTAAGAAGTTAAACTCATGGCGATGG[C/G]
TGAGTACGCTGCTCCGGCGATCGTCTCCTCCTCCGCGCGCCTCCTCGCCAGACGCCGAGGCACTGCGGCCAACGTCACCGGCCGCCGAGCGCACAAGTTC

Reverse complement sequence

GAACTTGTGCGCTCGGCGGCCGGTGACGTTGGCCGCAGTGCCTCGGCGTCTGGCGAGGAGGCGCGCGGAGGAGGAGACGATCGCCGGAGCAGCGTACTCA[G/C]
CCATCGCCATGAGTTTAACTTCTTAGTTTTCTTTTGTTTTCCTTCTCTTTCTGTTCAGATCATCATGCATGCACAAGATGGCGACGAGGCGAGTTTCCGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.30%	41.20%	10.73%	5.78%	NA
All Indica	2759	14.90%	66.10%	13.99%	5.00%	NA
All Japonica	1512	85.90%	1.90%	3.77%	8.40%	NA
Aus	269	57.60%	24.20%	18.22%	0.00%	NA
Indica I	595	10.30%	67.70%	16.81%	5.21%	NA
Indica II	465	15.30%	54.20%	29.03%	1.51%	NA
Indica III	913	12.70%	74.50%	6.24%	6.57%	NA
Indica Intermediate	786	20.70%	62.20%	11.96%	5.09%	NA
Temperate Japonica	767	95.20%	0.40%	0.65%	3.78%	NA
Tropical Japonica	504	82.30%	3.40%	6.55%	7.74%	NA
Japonica Intermediate	241	63.90%	3.70%	7.88%	24.48%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	45.60%	28.90%	16.67%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0808210049	C -> G	LOC_Os08g13770.1	upstream_gene_variant ; 78.0bp to feature; MODIFIER	silent_mutation	Average:33.796; most accessible tissue: Callus, score: 61.447	N	N	N	N
vg0808210049	C -> G	LOC_Os08g13770-LOC_Os08g13780	intergenic_region ; MODIFIER	silent_mutation	Average:33.796; most accessible tissue: Callus, score: 61.447	N	N	N	N
vg0808210049	C -> DEL	N	N	silent_mutation	Average:33.796; most accessible tissue: Callus, score: 61.447	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0808210049	NA	6.64E-14	mr1376	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808210049	NA	6.64E-14	mr1431	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808210049	NA	2.71E-12	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808210049	2.87E-07	3.03E-07	mr1296_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808210049	NA	2.43E-10	mr1660_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808210049	NA	3.26E-06	mr1749_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808210049	NA	5.12E-11	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251