Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808078578:

Variant ID: vg0808078578 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 8078578
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 363. )

Flanking Sequence (100 bp) in Reference Genome:

TTGTTGTTGGTCTTCTCACCATCTTTGTCTTCTCTTTTGCCTCTCCCAAGATTAGGACAATGCGAACGAAGATGATGAATTGAACCACATTCAAAGCAAC[G/A]
ATTTGGACCACCTCTTTTCCTGTTCCTGGCATTATTCATAGCTCGAGCAATTCTGTTAGCAACCAAAGCCAAATCCTCCTCCTCGATTTGTTCGAGTTGA

Reverse complement sequence

TCAACTCGAACAAATCGAGGAGGAGGATTTGGCTTTGGTTGCTAACAGAATTGCTCGAGCTATGAATAATGCCAGGAACAGGAAAAGAGGTGGTCCAAAT[C/T]
GTTGCTTTGAATGTGGTTCAATTCATCATCTTCGTTCGCATTGTCCTAATCTTGGGAGAGGCAAAAGAGAAGACAAAGATGGTGAGAAGACCAACAACAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.50%	2.40%	0.34%	0.74%	NA
All Indica	2759	95.60%	4.10%	0.25%	0.00%	NA
All Japonica	1512	97.20%	0.00%	0.46%	2.31%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	89.60%	9.70%	0.67%	0.00%	NA
Indica II	465	96.80%	3.00%	0.22%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	94.40%	5.30%	0.25%	0.00%	NA
Temperate Japonica	767	98.40%	0.00%	0.13%	1.43%	NA
Tropical Japonica	504	98.80%	0.00%	0.20%	0.99%	NA
Japonica Intermediate	241	90.00%	0.00%	2.07%	7.88%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	0.00%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0808078578	G -> A	LOC_Os08g13590.1	missense_variant ; p.Arg156Cys; MODERATE	nonsynonymous_codon ; R156C	Average:20.467; most accessible tissue: Zhenshan97 flag leaf, score: 31.305	benign	0.467	DELETERIOUS	0.02
vg0808078578	G -> DEL	LOC_Os08g13590.1	N	frameshift_variant	Average:20.467; most accessible tissue: Zhenshan97 flag leaf, score: 31.305	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0808078578	NA	6.62E-06	mr1020	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808078578	NA	1.56E-06	mr1021	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808078578	NA	1.92E-06	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808078578	NA	3.94E-07	mr1165	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808078578	NA	7.58E-06	mr1478	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808078578	NA	5.04E-06	mr1553	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808078578	NA	3.81E-07	mr1060_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808078578	NA	1.51E-07	mr1060_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808078578	NA	4.18E-07	mr1125_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808078578	NA	1.63E-08	mr1165_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808078578	NA	9.18E-06	mr1268_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808078578	NA	2.76E-07	mr1477_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808078578	NA	3.29E-08	mr1478_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808078578	NA	2.82E-06	mr1616_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808078578	NA	9.38E-06	mr1616_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808078578	NA	6.36E-07	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808078578	NA	2.44E-07	mr1971_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808078578	NA	6.26E-06	mr1996_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251