Search for Variation information by Variation ID:
Detailed information for vg0808053956:
| Variant ID: vg0808053956 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 8053956 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 327. )
Flanking Sequence (100 bp) in Reference Genome:
TGAGTTACGTATTGTGGATACATTTTTCTGCGTCCCATAACGTAGCGTTATATGAGGCGCTTCTCCACGGATTAAGGATTGCGATATCTTTGGGAATTCG[G/A,T]
CGTCTAATAGTTCGTGGAGATTCTCAGTTGGTTGTTAATCAAGTCATGAAAGAGTGGTCCTGCCTTGACAATAATATTATTGCTTATCGGCAAGAGGTAT
Reverse complement sequence
ATACCTCTTGCCGATAAGCAATAATATTATTGTCAAGGCAGGACCACTCTTTCATGACTTGATTAACAACCAACTGAGAATCTCCACGAACTATTAGACG[C/T,A]
CGAATTCCCAAAGATATCGCAATCCTTAATCCGTGGAGAAGCGCCTCATATAACGCTACGTTATGGGACGCAGAAAAATGTATCCACAATACGTAACTCA
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.60% | 4.50% | 0.08% | 0.78% | NA |
| All Indica | 2759 | 99.60% | 0.30% | 0.00% | 0.11% | NA |
| All Japonica | 1512 | 93.10% | 5.70% | 0.07% | 1.12% | NA |
| Aus | 269 | 54.60% | 39.00% | 0.74% | 5.58% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.70% | 0.90% | 0.00% | 0.38% | NA |
| Temperate Japonica | 767 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 83.70% | 13.10% | 0.20% | 2.98% | NA |
| Japonica Intermediate | 241 | 92.90% | 6.20% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 93.80% | 5.20% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 90.00% | 7.80% | 1.11% | 1.11% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0808053956 | G -> T | LOC_Os08g13550.1 | synonymous_variant ; p.Arg166Arg; LOW | N | Average:56.114; most accessible tissue: Minghui63 young leaf, score: 77.243 | N | N | N | N |
| vg0808053956 | G -> T | LOC_Os08g13540.1 | downstream_gene_variant ; 1775.0bp to feature; MODIFIER | N | Average:56.114; most accessible tissue: Minghui63 young leaf, score: 77.243 | N | N | N | N |
| vg0808053956 | G -> T | LOC_Os08g13560.1 | downstream_gene_variant ; 1846.0bp to feature; MODIFIER | N | Average:56.114; most accessible tissue: Minghui63 young leaf, score: 77.243 | N | N | N | N |
| vg0808053956 | G -> A | LOC_Os08g13550.1 | synonymous_variant ; p.Arg166Arg; LOW | synonymous_codon | Average:56.114; most accessible tissue: Minghui63 young leaf, score: 77.243 | N | N | N | N |
| vg0808053956 | G -> A | LOC_Os08g13550.1 | synonymous_variant ; p.Arg166Arg; LOW | nonsynonymous_codon ; R166Q | Average:56.114; most accessible tissue: Minghui63 young leaf, score: 77.243 | benign  |
0.575 |
DELETERIOUS | 0.03 |
| vg0808053956 | G -> DEL | LOC_Os08g13550.1 | N | frameshift_variant | Average:56.114; most accessible tissue: Minghui63 young leaf, score: 77.243 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0808053956 | NA | 3.40E-07 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808053956 | NA | 2.01E-07 | mr1207 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808053956 | NA | 2.55E-06 | mr1262 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808053956 | NA | 2.17E-07 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808053956 | NA | 2.44E-06 | mr1634 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808053956 | 2.68E-06 | NA | mr1723 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808053956 | NA | 7.98E-06 | mr1759 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |