Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0807910368:

Variant ID: vg0807910368 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 7910368
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CACTTCTCAGCCATTTCTCAAGAGAGGTAAGTCAGGAGGAAGCCGAGCACTTATCGCTCGGGCACGCACCGCACTTCACATCTAGCAATTCCACCAAAAT[T/C]
AAATTTAAATTGAACCTACACATTGAGAAAAAAACAAATTCAAGAATGAATATATATAGTATCACTATTATATTCATATCCAAATTTATTTTTTTATACT

Reverse complement sequence

AGTATAAAAAAATAAATTTGGATATGAATATAATAGTGATACTATATATATTCATTCTTGAATTTGTTTTTTTCTCAATGTGTAGGTTCAATTTAAATTT[A/G]
ATTTTGGTGGAATTGCTAGATGTGAAGTGCGGTGCGTGCCCGAGCGATAAGTGCTCGGCTTCCTCCTGACTTACCTCTCTTGAGAAATGGCTGAGAAGTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.90%	32.10%	0.00%	0.00%	NA
All Indica	2759	97.20%	2.80%	0.00%	0.00%	NA
All Japonica	1512	11.40%	88.60%	0.00%	0.00%	NA
Aus	269	97.80%	2.20%	0.00%	0.00%	NA
Indica I	595	95.00%	5.00%	0.00%	0.00%	NA
Indica II	465	97.00%	3.00%	0.00%	0.00%	NA
Indica III	913	98.50%	1.50%	0.00%	0.00%	NA
Indica Intermediate	786	97.50%	2.50%	0.00%	0.00%	NA
Temperate Japonica	767	2.70%	97.30%	0.00%	0.00%	NA
Tropical Japonica	504	22.60%	77.40%	0.00%	0.00%	NA
Japonica Intermediate	241	15.80%	84.20%	0.00%	0.00%	NA
VI/Aromatic	96	32.30%	67.70%	0.00%	0.00%	NA
Intermediate	90	68.90%	31.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0807910368	T -> C	LOC_Os08g13310.1	upstream_gene_variant ; 1356.0bp to feature; MODIFIER	silent_mutation	Average:66.267; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0807910368	T -> C	LOC_Os08g13320.1	upstream_gene_variant ; 1431.0bp to feature; MODIFIER	silent_mutation	Average:66.267; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0807910368	T -> C	LOC_Os08g13300.1	downstream_gene_variant ; 2598.0bp to feature; MODIFIER	silent_mutation	Average:66.267; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0807910368	T -> C	LOC_Os08g13310-LOC_Os08g13320	intergenic_region ; MODIFIER	silent_mutation	Average:66.267; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0807910368	NA	1.38E-12	mr1010	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807910368	NA	1.40E-06	mr1011	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807910368	2.77E-06	2.77E-06	mr1011	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807910368	NA	1.39E-14	mr1376	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807910368	NA	2.18E-12	mr1386	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807910368	NA	1.39E-14	mr1431	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807910368	NA	1.16E-06	mr1587	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807910368	NA	1.52E-12	mr1667	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807910368	NA	1.17E-14	mr1909	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807910368	NA	9.54E-12	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807910368	NA	1.14E-19	mr1731_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251