| Variant ID: vg0807677059 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr08 | Position: 7677059 |
| Reference Allele: A | Alternative Allele: G,AGAT |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.59, A: 0.41, others allele: 0.00, population size: 39. )
GGACATCGCCGCAAGGCAGCGACCCCCTCGATAATTTCATCTTGTCGTCAGATCGTGCAGCAAGGAGGGTTTCTTCTTACTCTGTATTGATTGTCTTTCA[A/G,AGAT]
GCAGCGCATTGTGACGATCGGCGAGAAGTAAGTAAACAGATTCTTGGATTCTCGTGCTTCTCGTTCAAATGGTGTTTGATTCGTGGCTGTCCGTAGGGAG
CTCCCTACGGACAGCCACGAATCAAACACCATTTGAACGAGAAGCACGAGAATCCAAGAATCTGTTTACTTACTTCTCGCCGATCGTCACAATGCGCTGC[T/C,ATCT]
TGAAAGACAATCAATACAGAGTAAGAAGAAACCCTCCTTGCTGCACGATCTGACGACAAGATGAAATTATCGAGGGGGTCGCTGCCTTGCGGCGATGTCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.10% | 28.00% | 7.15% | 4.72% | NA |
| All Indica | 2759 | 85.80% | 1.60% | 5.47% | 7.07% | NA |
| All Japonica | 1512 | 5.20% | 81.70% | 11.31% | 1.72% | NA |
| Aus | 269 | 94.80% | 1.50% | 2.97% | 0.74% | NA |
| Indica I | 595 | 97.10% | 1.00% | 0.34% | 1.51% | NA |
| Indica II | 465 | 65.40% | 3.40% | 19.14% | 12.04% | NA |
| Indica III | 913 | 85.40% | 1.10% | 3.40% | 10.08% | NA |
| Indica Intermediate | 786 | 89.80% | 1.70% | 3.69% | 4.83% | NA |
| Temperate Japonica | 767 | 4.00% | 74.80% | 18.90% | 2.22% | NA |
| Tropical Japonica | 504 | 6.00% | 93.50% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 7.50% | 79.30% | 10.79% | 2.49% | NA |
| VI/Aromatic | 96 | 93.80% | 4.20% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 40.00% | 6.67% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0807677059 | A -> G | LOC_Os08g12910.1 | splice_region_variant&intron_variant ; LOW | silent_mutation | Average:40.639; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0807677059 | A -> G | LOC_Os08g12900.1 | downstream_gene_variant ; 3145.0bp to feature; MODIFIER | silent_mutation | Average:40.639; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0807677059 | A -> G | LOC_Os08g12920.1 | downstream_gene_variant ; 2350.0bp to feature; MODIFIER | silent_mutation | Average:40.639; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0807677059 | A -> AGAT | LOC_Os08g12910.1 | splice_region_variant&intron_variant ; LOW | N | Average:40.639; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0807677059 | A -> AGAT | LOC_Os08g12900.1 | downstream_gene_variant ; 3146.0bp to feature; MODIFIER | N | Average:40.639; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0807677059 | A -> AGAT | LOC_Os08g12920.1 | downstream_gene_variant ; 2349.0bp to feature; MODIFIER | N | Average:40.639; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0807677059 | A -> DEL | N | N | silent_mutation | Average:40.639; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0807677059 | NA | 7.93E-09 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807677059 | NA | 7.71E-12 | mr1281 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807677059 | NA | 1.45E-06 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807677059 | 5.81E-07 | 1.81E-19 | mr1842 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807677059 | NA | 3.00E-11 | mr1902 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807677059 | NA | 9.66E-06 | mr1539_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807677059 | NA | 4.99E-06 | mr1806_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807677059 | NA | 1.43E-07 | mr1828_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807677059 | NA | 3.60E-22 | mr1933_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |