Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0806865309:

Variant ID: vg0806865309 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 6865309
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: Unkown

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

TGGGACCCATGTGTCATCCAATCACAGCCAACATACCATCCACTCATCTCTCTTTTAATCTTTCTTTTATTTCTCAAAAGGTGAGATAAGGGTTAAAATA[C/T]
AATTCTCACCATATAATTTACATTACTACTCACACATGCCTAGAGTACATCTTCATGGGCCCTTTAGTAATTCACATGCAACCAATCAACATTAGTTAAT

Reverse complement sequence

ATTAACTAATGTTGATTGGTTGCATGTGAATTACTAAAGGGCCCATGAAGATGTACTCTAGGCATGTGTGAGTAGTAATGTAAATTATATGGTGAGAATT[G/A]
TATTTTAACCCTTATCTCACCTTTTGAGAAATAAAAGAAAGATTAAAAGAGAGATGAGTGGATGGTATGTTGGCTGTGATTGGATGACACATGGGTCCCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of Unkown(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	99.50%	0.00%	0.15%	0.38%	NA
All Indica	2759	100.00%	0.00%	0.00%	0.00%	NA
All Japonica	1512	98.30%	0.00%	0.46%	1.19%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	98.30%	0.00%	0.26%	1.43%	NA
Tropical Japonica	504	99.40%	0.00%	0.40%	0.20%	NA
Japonica Intermediate	241	96.30%	0.00%	1.24%	2.49%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0806865309	C -> T	LOC_Os08g11720.1	downstream_gene_variant ; 1125.0bp to feature; MODIFIER	N	Average:25.057; most accessible tissue: Minghui63 root, score: 57.225	N	N	N	N
vg0806865309	C -> T	LOC_Os08g11720.3	downstream_gene_variant ; 1126.0bp to feature; MODIFIER	N	Average:25.057; most accessible tissue: Minghui63 root, score: 57.225	N	N	N	N
vg0806865309	C -> T	LOC_Os08g11720.2	downstream_gene_variant ; 1126.0bp to feature; MODIFIER	N	Average:25.057; most accessible tissue: Minghui63 root, score: 57.225	N	N	N	N
vg0806865309	C -> T	LOC_Os08g11700-LOC_Os08g11720	intergenic_region ; MODIFIER	N	Average:25.057; most accessible tissue: Minghui63 root, score: 57.225	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0806865309	NA	1.94E-06	mr1082	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806865309	NA	4.24E-06	mr1083	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806865309	2.95E-06	4.53E-08	mr1085	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806865309	NA	5.23E-07	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806865309	NA	1.62E-08	mr1226	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806865309	NA	3.95E-07	mr1411	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806865309	NA	2.79E-07	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251