Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0806183176:

Variant ID: vg0806183176 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 6183176
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAGAATAATCACAGTATCCGTCACATAAGGGGGTGTTTAGATCCAGGAATGTAAAGTTTTTGCGTGTAATATAATTATAGAATCCGTTAGTAAACCGCAA[A/G]
ACAAATTTATTAAGCCTAATTAATCCGTCATTAGCAAATCTTTGCTGTAGCACCACATTGTCAAATCATGGAGCAATTAGGCTTAAAATATTCGTCTCAC

Reverse complement sequence

GTGAGACGAATATTTTAAGCCTAATTGCTCCATGATTTGACAATGTGGTGCTACAGCAAAGATTTGCTAATGACGGATTAATTAGGCTTAATAAATTTGT[T/C]
TTGCGGTTTACTAACGGATTCTATAATTATATTACACGCAAAAACTTTACATTCCTGGATCTAAACACCCCCTTATGTGACGGATACTGTGATTATTCTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.20%	33.90%	0.19%	4.70%	NA
All Indica	2759	80.70%	13.00%	0.07%	6.23%	NA
All Japonica	1512	21.20%	78.50%	0.26%	0.07%	NA
Aus	269	78.10%	4.50%	0.00%	17.47%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	61.10%	10.80%	0.22%	27.96%	NA
Indica III	913	77.40%	22.30%	0.00%	0.22%	NA
Indica Intermediate	786	81.90%	12.80%	0.13%	5.09%	NA
Temperate Japonica	767	32.70%	66.80%	0.52%	0.00%	NA
Tropical Japonica	504	6.20%	93.80%	0.00%	0.00%	NA
Japonica Intermediate	241	15.80%	83.80%	0.00%	0.41%	NA
VI/Aromatic	96	92.70%	6.20%	0.00%	1.04%	NA
Intermediate	90	51.10%	44.40%	3.33%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0806183176	A -> G	LOC_Os08g10530.1	upstream_gene_variant ; 1419.0bp to feature; MODIFIER	silent_mutation	Average:53.294; most accessible tissue: Callus, score: 80.221	N	N	N	N
vg0806183176	A -> G	LOC_Os08g10520.1	downstream_gene_variant ; 4159.0bp to feature; MODIFIER	silent_mutation	Average:53.294; most accessible tissue: Callus, score: 80.221	N	N	N	N
vg0806183176	A -> G	LOC_Os08g10530-LOC_Os08g10540	intergenic_region ; MODIFIER	silent_mutation	Average:53.294; most accessible tissue: Callus, score: 80.221	N	N	N	N
vg0806183176	A -> DEL	N	N	silent_mutation	Average:53.294; most accessible tissue: Callus, score: 80.221	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0806183176	NA	2.96E-07	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806183176	NA	1.49E-13	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806183176	NA	5.41E-06	mr1035	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806183176	1.91E-07	2.69E-22	mr1062	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806183176	NA	1.53E-08	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806183176	NA	1.15E-06	mr1425	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806183176	NA	1.94E-08	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806183176	NA	1.09E-14	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806183176	NA	8.47E-06	mr1035_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806183176	NA	2.22E-06	mr1631_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251