Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0806098917:

Variant ID: vg0806098917 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 6098917
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:

TTTCGAGAACAATTGAGCACTCGAGTAGGTTGTGGTCAAACACTCACATTATCGAGAACGTTCTCGACAAATGCAGAGTTGTCGCACCCAACTTACCAAT[G/A]
AAGACCGACGACCTATCTCATAGCACCGGCCATAGCTGAGCTATTCGAGAAAAGGTTGTTAACGGATAATTCCTCGTAAACATTGTTGGCTTGATCACCC

Reverse complement sequence

GGGTGATCAAGCCAACAATGTTTACGAGGAATTATCCGTTAACAACCTTTTCTCGAATAGCTCAGCTATGGCCGGTGCTATGAGATAGGTCGTCGGTCTT[C/T]
ATTGGTAAGTTGGGTGCGACAACTCTGCATTTGTCGAGAACGTTCTCGATAATGTGAGTGTTTGACCACAACCTACTCGAGTGCTCAATTGTTCTCGAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.30%	6.60%	2.84%	0.32%	NA
All Indica	2759	84.00%	11.20%	4.78%	0.04%	NA
All Japonica	1512	99.10%	0.00%	0.07%	0.79%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	53.60%	30.60%	15.80%	0.00%	NA
Indica II	465	90.50%	6.50%	3.01%	0.00%	NA
Indica III	913	99.70%	0.20%	0.00%	0.11%	NA
Indica Intermediate	786	85.00%	12.00%	3.05%	0.00%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	97.80%	0.00%	0.00%	2.18%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	94.40%	3.30%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0806098917	G -> A	LOC_Os08g10400.1	downstream_gene_variant ; 4056.0bp to feature; MODIFIER	silent_mutation	Average:39.201; most accessible tissue: Minghui63 flag leaf, score: 49.864	N	N	N	N
vg0806098917	G -> A	LOC_Os08g10390.1	intron_variant ; MODIFIER	silent_mutation	Average:39.201; most accessible tissue: Minghui63 flag leaf, score: 49.864	N	N	N	N
vg0806098917	G -> DEL	N	N	silent_mutation	Average:39.201; most accessible tissue: Minghui63 flag leaf, score: 49.864	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0806098917	NA	3.65E-06	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806098917	NA	6.01E-06	mr1045_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806098917	NA	5.98E-09	mr1220_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806098917	NA	1.94E-06	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806098917	4.73E-07	4.73E-07	mr1615_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806098917	NA	5.83E-06	mr1629_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806098917	NA	9.18E-06	mr1729_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251