Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805936415:

Variant ID: vg0805936415 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 5936415
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.10, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

GGAGCCCGCACACTGTCGTCATGCCGTTCGGCTACTACACCTCTGCTTCATTGCGCCGGACTTGTGATGCCATTATCCGTCCGCGATGACTATTCTTCGC[T/C]
GAGTCGCTGAGGCGCTGCCAAGCAGAGCTCATCTCCGTCAACTAACCATCACCTGCCACCTGCCGGAGAAGGCCGTTGTGACGCCACCCAGCCGGAGCGT

Reverse complement sequence

ACGCTCCGGCTGGGTGGCGTCACAACGGCCTTCTCCGGCAGGTGGCAGGTGATGGTTAGTTGACGGAGATGAGCTCTGCTTGGCAGCGCCTCAGCGACTC[A/G]
GCGAAGAATAGTCATCGCGGACGGATAATGGCATCACAAGTCCGGCGCAATGAAGCAGAGGTGTAGTAGCCGAACGGCATGACGACAGTGTGCGGGCTCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	30.40%	9.80%	2.92%	56.86%	NA
All Indica	2759	2.80%	8.60%	4.71%	83.91%	NA
All Japonica	1512	86.80%	8.70%	0.33%	4.17%	NA
Aus	269	2.20%	9.30%	0.37%	88.10%	NA
Indica I	595	3.50%	0.00%	3.53%	92.94%	NA
Indica II	465	4.30%	34.80%	3.66%	57.20%	NA
Indica III	913	1.10%	2.60%	6.02%	90.25%	NA
Indica Intermediate	786	3.30%	6.50%	4.71%	85.50%	NA
Temperate Japonica	767	94.70%	3.10%	0.13%	2.09%	NA
Tropical Japonica	504	79.60%	16.10%	0.60%	3.77%	NA
Japonica Intermediate	241	76.80%	11.20%	0.41%	11.62%	NA
VI/Aromatic	96	3.10%	60.40%	0.00%	36.46%	NA
Intermediate	90	45.60%	11.10%	2.22%	41.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0805936415	T -> C	LOC_Os08g10220.1	downstream_gene_variant ; 3966.0bp to feature; MODIFIER	silent_mutation	Average:30.775; most accessible tissue: Minghui63 root, score: 55.188	N	N	N	N
vg0805936415	T -> C	LOC_Os08g10230.1	downstream_gene_variant ; 608.0bp to feature; MODIFIER	silent_mutation	Average:30.775; most accessible tissue: Minghui63 root, score: 55.188	N	N	N	N
vg0805936415	T -> C	LOC_Os08g10240.1	downstream_gene_variant ; 3116.0bp to feature; MODIFIER	silent_mutation	Average:30.775; most accessible tissue: Minghui63 root, score: 55.188	N	N	N	N
vg0805936415	T -> C	LOC_Os08g10230-LOC_Os08g10240	intergenic_region ; MODIFIER	silent_mutation	Average:30.775; most accessible tissue: Minghui63 root, score: 55.188	N	N	N	N
vg0805936415	T -> DEL	N	N	silent_mutation	Average:30.775; most accessible tissue: Minghui63 root, score: 55.188	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0805936415	NA	7.48E-06	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805936415	5.41E-06	1.23E-06	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805936415	6.40E-09	4.42E-10	mr1682	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805936415	4.68E-07	NA	mr1754	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805936415	NA	1.27E-06	mr1633_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805936415	2.41E-07	2.28E-08	mr1830_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805936415	7.49E-06	7.49E-06	mr1960_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251