Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805902939:

Variant ID: vg0805902939 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 5902939
Reference Allele: C	Alternative Allele: A,T
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTCAAAGTGAAATGGTACCGAATGGTTTATACCTGGAGGATTTTCTGAACATTGGCATGGGGCGGCTAGACGTTTTCTTCTTCGGAGCAGCGTGCTTCGG[C/A,T]
AATTTTTTGGGTGATCCCATATCCCCAAGTTTAGTGTTGTCATCGCCTTCGTCGTCGCTCAGCACAAGCTTTCTTTTGTGAGAATCTGCTTGCCCAGTCG

Reverse complement sequence

CGACTGGGCAAGCAGATTCTCACAAAAGAAAGCTTGTGCTGAGCGACGACGAAGGCGATGACAACACTAAACTTGGGGATATGGGATCACCCAAAAAATT[G/T,A]
CCGAAGCACGCTGCTCCGAAGAAGAAAACGTCTAGCCGCCCCATGCCAATGTTCAGAAAATCCTCCAGGTATAAACCATTCGGTACCATTTCACTTTGAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.20%	0.10%	9.23%	38.45%	T: 0.04%
All Indica	2759	27.30%	0.10%	14.43%	58.14%	T: 0.07%
All Japonica	1512	95.10%	0.00%	0.46%	4.43%	NA
Aus	269	65.10%	0.00%	4.09%	30.86%	NA
Indica I	595	28.20%	0.00%	7.73%	64.03%	NA
Indica II	465	46.50%	0.00%	10.11%	43.44%	NA
Indica III	913	15.90%	0.20%	21.25%	62.65%	NA
Indica Intermediate	786	28.40%	0.10%	14.12%	57.12%	T: 0.25%
Temperate Japonica	767	98.30%	0.00%	0.13%	1.56%	NA
Tropical Japonica	504	93.30%	0.00%	0.40%	6.35%	NA
Japonica Intermediate	241	88.80%	0.00%	1.66%	9.54%	NA
VI/Aromatic	96	51.00%	2.10%	14.58%	32.29%	NA
Intermediate	90	57.80%	0.00%	6.67%	35.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0805902939	C -> T	LOC_Os08g10180.1	synonymous_variant ; p.Leu334Leu; LOW	synonymous_codon	Average:29.665; most accessible tissue: Minghui63 flag leaf, score: 57.881	N	N	N	N
vg0805902939	C -> A	LOC_Os08g10180.1	missense_variant ; p.Leu334Phe; MODERATE	nonsynonymous_codon ; L334F	Average:29.665; most accessible tissue: Minghui63 flag leaf, score: 57.881	unknown	unknown	TOLERATED	0.26
vg0805902939	C -> DEL	LOC_Os08g10180.1	N	frameshift_variant	Average:29.665; most accessible tissue: Minghui63 flag leaf, score: 57.881	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0805902939	NA	8.91E-09	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805902939	3.21E-06	3.81E-09	mr1309	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805902939	NA	3.18E-09	mr1841	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805902939	5.03E-10	5.03E-10	mr1900	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805902939	NA	1.06E-07	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805902939	NA	8.04E-07	mr1484_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805902939	NA	2.26E-07	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805902939	NA	2.88E-07	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251