Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805901665:

Variant ID: vg0805901665 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 5901665
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAGTAGCGGCATTTGCGACCTCATCCCTGGCTCCTTCAAGTCTTTTAATCTTGCCGACCAGGACATCGAACTGGGCTTGCGACTTTATCTTGCGATCTAC[G/A]
ACAACAAAGCCATGTTAATGATTTGCTGTATTAAAGAGAGAAAATCAGGTTGCTGGTGAACAATACCTTCAACCTCCTTCACAGCCGAGTCCCTTTGTGC

Reverse complement sequence

GCACAAAGGGACTCGGCTGTGAAGGAGGTTGAAGGTATTGTTCACCAGCAACCTGATTTTCTCTCTTTAATACAGCAAATCATTAACATGGCTTTGTTGT[C/T]
GTAGATCGCAAGATAAAGTCGCAAGCCCAGTTCGATGTCCTGGTCGGCAAGATTAAAAGACTTGAAGGAGCCAGGGATGAGGTCGCAAATGCCGCTACTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.50%	7.30%	3.64%	44.48%	NA
All Indica	2759	20.60%	9.60%	4.31%	65.49%	NA
All Japonica	1512	94.80%	0.50%	0.46%	4.23%	NA
Aus	269	16.40%	26.00%	14.50%	43.12%	NA
Indica I	595	23.40%	2.40%	5.21%	69.08%	NA
Indica II	465	43.20%	4.90%	3.87%	47.96%	NA
Indica III	913	7.20%	16.30%	3.29%	73.17%	NA
Indica Intermediate	786	20.70%	9.90%	5.09%	64.25%	NA
Temperate Japonica	767	98.20%	0.00%	0.00%	1.83%	NA
Tropical Japonica	504	93.30%	0.60%	0.79%	5.36%	NA
Japonica Intermediate	241	87.60%	1.70%	1.24%	9.54%	NA
VI/Aromatic	96	10.40%	3.10%	4.17%	82.29%	NA
Intermediate	90	53.30%	3.30%	3.33%	40.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0805901665	G -> A	LOC_Os08g10180.1	splice_region_variant&intron_variant ; LOW	silent_mutation	Average:25.806; most accessible tissue: Minghui63 young leaf, score: 64.378	N	N	N	N
vg0805901665	G -> A	LOC_Os08g10160.1	downstream_gene_variant ; 3944.0bp to feature; MODIFIER	silent_mutation	Average:25.806; most accessible tissue: Minghui63 young leaf, score: 64.378	N	N	N	N
vg0805901665	G -> DEL	N	N	silent_mutation	Average:25.806; most accessible tissue: Minghui63 young leaf, score: 64.378	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0805901665	NA	1.42E-07	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805901665	NA	1.59E-07	mr1309	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805901665	NA	3.04E-07	mr1835	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805901665	3.58E-07	9.29E-11	mr1841	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805901665	3.71E-09	3.71E-09	mr1900	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805901665	NA	2.42E-07	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805901665	NA	2.21E-06	mr1484_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805901665	NA	4.82E-08	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805901665	NA	9.11E-07	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251