Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805695351:

Variant ID: vg0805695351 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 5695351
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTAGGATGCATCTTTATTAGTCTATTAAGGCATTAATGTGTTCTGTTTTTTAAGTTCGCTATTAAAATTAATAAAAGAACATATTCCTTTATTACCATG[G/T]
AGATGATAAAATATGTTTTAGTTGTCATATCACTGAAAAAGTGGCATTTCAAATTGCAGGTTTATATACTAATAGAACGGTGATTCCAAACAATGCTTGC

Reverse complement sequence

GCAAGCATTGTTTGGAATCACCGTTCTATTAGTATATAAACCTGCAATTTGAAATGCCACTTTTTCAGTGATATGACAACTAAAACATATTTTATCATCT[C/A]
CATGGTAATAAAGGAATATGTTCTTTTATTAATTTTAATAGCGAACTTAAAAAACAGAACACATTAATGCCTTAATAGACTAATAAAGATGCATCCTAGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.20%	9.60%	2.90%	21.22%	NA
All Indica	2759	51.30%	14.60%	4.28%	29.79%	NA
All Japonica	1512	99.40%	0.10%	0.33%	0.13%	NA
Aus	269	23.80%	18.20%	3.35%	54.65%	NA
Indica I	595	55.00%	7.60%	5.04%	32.44%	NA
Indica II	465	66.70%	3.20%	6.02%	24.09%	NA
Indica III	913	37.10%	24.10%	3.07%	35.71%	NA
Indica Intermediate	786	55.90%	15.80%	4.07%	24.30%	NA
Temperate Japonica	767	99.70%	0.00%	0.26%	0.00%	NA
Tropical Japonica	504	99.40%	0.20%	0.00%	0.40%	NA
Japonica Intermediate	241	98.30%	0.40%	1.24%	0.00%	NA
VI/Aromatic	96	75.00%	0.00%	1.04%	23.96%	NA
Intermediate	90	84.40%	1.10%	4.44%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0805695351	G -> T	LOC_Os08g09870.1	downstream_gene_variant ; 1305.0bp to feature; MODIFIER	silent_mutation	Average:43.547; most accessible tissue: Minghui63 flag leaf, score: 84.227	N	N	N	N
vg0805695351	G -> T	LOC_Os08g09880.1	downstream_gene_variant ; 4908.0bp to feature; MODIFIER	silent_mutation	Average:43.547; most accessible tissue: Minghui63 flag leaf, score: 84.227	N	N	N	N
vg0805695351	G -> T	LOC_Os08g09860.1	intron_variant ; MODIFIER	silent_mutation	Average:43.547; most accessible tissue: Minghui63 flag leaf, score: 84.227	N	N	N	N
vg0805695351	G -> DEL	N	N	silent_mutation	Average:43.547; most accessible tissue: Minghui63 flag leaf, score: 84.227	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0805695351	NA	3.20E-07	mr1038	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805695351	NA	2.01E-06	mr1209	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805695351	NA	1.12E-08	mr1389	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805695351	NA	6.18E-07	mr1706	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805695351	9.17E-07	NA	mr1807	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805695351	4.14E-06	6.33E-06	mr1807	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805695351	7.23E-06	7.18E-06	mr1954	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805695351	NA	2.13E-06	mr1038_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805695351	NA	2.18E-06	mr1553_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805695351	NA	3.13E-06	mr1970_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251