Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805548986:

Variant ID: vg0805548986 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 5548986
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.58, T: 0.42, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:

TTAGTTTGTAGAATATAGTGGAATTGAAATAGAATAGAATCTTCAGTCCTCGGAGTCTTCGGAAGAATTCGGGTATGGCTCTAGTAGCTTTTCCTTCTTT[C/T]
GTAAGACTTGTACTTTTATTAGAATAATCTTCTTTATACTACTCTGATATTGTATTACTTTCCAAGTATATGAATACCAATTTTACTATATGTTCGAATT

Reverse complement sequence

AATTCGAACATATAGTAAAATTGGTATTCATATACTTGGAAAGTAATACAATATCAGAGTAGTATAAAGAAGATTATTCTAATAAAAGTACAAGTCTTAC[G/A]
AAAGAAGGAAAAGCTACTAGAGCCATACCCGAATTCTTCCGAAGACTCCGAGGACTGAAGATTCTATTCTATTTCAATTCCACTATATTCTACAAACTAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.00%	38.00%	0.28%	15.74%	NA
All Indica	2759	28.10%	52.20%	0.29%	19.43%	NA
All Japonica	1512	89.60%	1.10%	0.20%	9.06%	NA
Aus	269	0.00%	98.90%	0.00%	1.12%	NA
Indica I	595	62.00%	19.50%	0.17%	18.32%	NA
Indica II	465	24.50%	46.00%	0.43%	29.03%	NA
Indica III	913	6.50%	78.60%	0.11%	14.79%	NA
Indica Intermediate	786	29.50%	50.00%	0.51%	19.97%	NA
Temperate Japonica	767	97.40%	0.30%	0.26%	2.09%	NA
Tropical Japonica	504	80.20%	1.60%	0.20%	18.06%	NA
Japonica Intermediate	241	84.60%	2.90%	0.00%	12.45%	NA
VI/Aromatic	96	7.30%	37.50%	1.04%	54.17%	NA
Intermediate	90	43.30%	37.80%	1.11%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0805548986	C -> T	LOC_Os08g09590.1	upstream_gene_variant ; 2357.0bp to feature; MODIFIER	silent_mutation	Average:44.866; most accessible tissue: Zhenshan97 young leaf, score: 64.747	N	N	N	N
vg0805548986	C -> T	LOC_Os08g09570.1	downstream_gene_variant ; 2805.0bp to feature; MODIFIER	silent_mutation	Average:44.866; most accessible tissue: Zhenshan97 young leaf, score: 64.747	N	N	N	N
vg0805548986	C -> T	LOC_Os08g09580.1	downstream_gene_variant ; 506.0bp to feature; MODIFIER	silent_mutation	Average:44.866; most accessible tissue: Zhenshan97 young leaf, score: 64.747	N	N	N	N
vg0805548986	C -> T	LOC_Os08g09570-LOC_Os08g09580	intergenic_region ; MODIFIER	silent_mutation	Average:44.866; most accessible tissue: Zhenshan97 young leaf, score: 64.747	N	N	N	N
vg0805548986	C -> DEL	N	N	silent_mutation	Average:44.866; most accessible tissue: Zhenshan97 young leaf, score: 64.747	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0805548986	NA	5.96E-06	mr1177	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548986	3.64E-06	3.49E-07	mr1177	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548986	NA	3.63E-07	mr1236	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548986	NA	1.51E-11	mr1553	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548986	NA	1.58E-07	mr1807	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548986	NA	7.34E-22	mr1817	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548986	NA	8.79E-09	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548986	NA	7.40E-12	mr1170_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548986	NA	2.77E-09	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548986	NA	8.24E-10	mr1221_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548986	NA	1.14E-06	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548986	NA	2.42E-07	mr1583_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548986	NA	3.34E-07	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548986	NA	4.70E-11	mr1807_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548986	NA	2.78E-09	mr1850_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548986	NA	2.27E-07	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251