Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805104629:

Variant ID: vg0805104629 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 5104629
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.12, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

ATTCTAGCATTTCCCACATTCATATTGATGCTAATGAATCTAGACATATACATCTATCTAGATTCATTGATATCAATATAAATGTGGGAAATGCTAAAAT[A/G]
ACTTATATTGTGAAACAGAGTAAGTAGTTAATATGTCCATCCCGTTGCAATGAGATCCCGTCTTGTAGCAGACATGCCGTATAAATCATCTCGTCGAATT

Reverse complement sequence

AATTCGACGAGATGATTTATACGGCATGTCTGCTACAAGACGGGATCTCATTGCAACGGGATGGACATATTAACTACTTACTCTGTTTCACAATATAAGT[T/C]
ATTTTAGCATTTCCCACATTTATATTGATATCAATGAATCTAGATAGATGTATATGTCTAGATTCATTAGCATCAATATGAATGTGGGAAATGCTAGAAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.40%	21.50%	0.08%	0.00%	NA
All Indica	2759	83.80%	16.20%	0.04%	0.00%	NA
All Japonica	1512	64.30%	35.60%	0.13%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	93.80%	6.20%	0.00%	0.00%	NA
Indica II	465	42.80%	57.00%	0.22%	0.00%	NA
Indica III	913	98.50%	1.50%	0.00%	0.00%	NA
Indica Intermediate	786	83.50%	16.50%	0.00%	0.00%	NA
Temperate Japonica	767	85.40%	14.30%	0.26%	0.00%	NA
Tropical Japonica	504	34.70%	65.30%	0.00%	0.00%	NA
Japonica Intermediate	241	58.90%	41.10%	0.00%	0.00%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	73.30%	25.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0805104629	A -> G	LOC_Os08g08820.1	upstream_gene_variant ; 4609.0bp to feature; MODIFIER	silent_mutation	Average:72.109; most accessible tissue: Minghui63 young leaf, score: 81.195	N	N	N	N
vg0805104629	A -> G	LOC_Os08g08820.2	upstream_gene_variant ; 4609.0bp to feature; MODIFIER	silent_mutation	Average:72.109; most accessible tissue: Minghui63 young leaf, score: 81.195	N	N	N	N
vg0805104629	A -> G	LOC_Os08g08810.1	downstream_gene_variant ; 2983.0bp to feature; MODIFIER	silent_mutation	Average:72.109; most accessible tissue: Minghui63 young leaf, score: 81.195	N	N	N	N
vg0805104629	A -> G	LOC_Os08g08800-LOC_Os08g08810	intergenic_region ; MODIFIER	silent_mutation	Average:72.109; most accessible tissue: Minghui63 young leaf, score: 81.195	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0805104629	NA	1.70E-08	mr1026	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104629	NA	5.65E-07	mr1063	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104629	NA	5.38E-08	mr1161	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104629	NA	1.72E-06	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104629	NA	4.62E-08	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104629	NA	5.44E-06	mr1263	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104629	NA	5.44E-06	mr1451	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104629	NA	1.01E-07	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104629	NA	7.68E-07	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104629	NA	9.03E-06	mr1851	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104629	NA	3.01E-09	mr1864	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104629	NA	2.88E-06	mr1161_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104629	NA	4.37E-06	mr1170_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104629	NA	3.64E-08	mr1180_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104629	NA	2.15E-07	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104629	NA	4.77E-09	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104629	NA	3.90E-06	mr1966_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251