Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805048816:

Variant ID: vg0805048816 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5048816
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, A: 0.22, others allele: 0.00, population size: 32. )

Flanking Sequence (100 bp) in Reference Genome:


GTGAGAGGAGGAATAGGCGTGTAGGGCTATATTATATGTGTAATAATGGAAGATAATACAGCTATATTTATAAGCGCAGGGAGACCGAAAGCTGGTCGTC[C/A]
CTACGGAAAAACCGTCCTTATGATCACGAACGCCGGAAAGCGCCAAAAAAGCTGTCGGTGTCATAAGCGCAGCTTGTTTTGTTGTTGTGGCCTTGTGTTG

Reverse complement sequence

CAACACAAGGCCACAACAACAAAACAAGCTGCGCTTATGACACCGACAGCTTTTTTGGCGCTTTCCGGCGTTCGTGATCATAAGGACGGTTTTTCCGTAG[G/T]
GACGACCAGCTTTCGGTCTCCCTGCGCTTATAAATATAGCTGTATTATCTTCCATTATTACACATATAATATAGCCCTACACGCCTATTCCTCCTCTCAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.20% 27.60% 0.23% 33.94% NA
All Indica  2759 53.20% 3.60% 0.25% 42.95% NA
All Japonica  1512 13.70% 75.30% 0.20% 10.85% NA
Aus  269 29.00% 12.30% 0.00% 58.74% NA
Indica I  595 89.90% 2.40% 0.17% 7.56% NA
Indica II  465 24.90% 6.90% 0.43% 67.74% NA
Indica III  913 43.90% 0.80% 0.11% 55.20% NA
Indica Intermediate  786 52.80% 6.00% 0.38% 40.84% NA
Temperate Japonica  767 2.10% 89.60% 0.26% 8.08% NA
Tropical Japonica  504 28.60% 59.70% 0.20% 11.51% NA
Japonica Intermediate  241 19.50% 62.20% 0.00% 18.26% NA
VI/Aromatic  96 19.80% 12.50% 0.00% 67.71% NA
Intermediate  90 37.80% 25.60% 1.11% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805048816 C -> A LOC_Os08g08710.1 upstream_gene_variant ; 204.0bp to feature; MODIFIER silent_mutation Average:52.253; most accessible tissue: Zhenshan97 root, score: 99.137 N N N N
vg0805048816 C -> A LOC_Os08g08720.1 upstream_gene_variant ; 3097.0bp to feature; MODIFIER silent_mutation Average:52.253; most accessible tissue: Zhenshan97 root, score: 99.137 N N N N
vg0805048816 C -> A LOC_Os08g08710-LOC_Os08g08720 intergenic_region ; MODIFIER silent_mutation Average:52.253; most accessible tissue: Zhenshan97 root, score: 99.137 N N N N
vg0805048816 C -> DEL N N silent_mutation Average:52.253; most accessible tissue: Zhenshan97 root, score: 99.137 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0805048816 C A 0.06 -0.04 -0.03 -0.05 -0.04 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805048816 NA 2.31E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805048816 NA 2.66E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805048816 NA 1.41E-07 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805048816 NA 1.88E-06 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805048816 NA 6.40E-14 mr1147_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805048816 NA 1.55E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805048816 8.56E-06 8.55E-06 mr1440_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805048816 NA 1.96E-09 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805048816 NA 1.28E-09 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805048816 NA 7.06E-08 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805048816 NA 1.12E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805048816 NA 5.26E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805048816 3.38E-06 NA mr1800_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805048816 NA 3.12E-06 mr1831_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805048816 NA 4.37E-09 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805048816 NA 5.00E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805048816 NA 5.01E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251