Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804975611:

Variant ID: vg0804975611 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 4975611
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, others allele: 0.00, population size: 41. )

Flanking Sequence (100 bp) in Reference Genome:

AGGTCAGGCGGTTTCCAAGTAGAACTCGGAGACATCGGACCCTACACGATACATTGACGACCCAGTCCTGTCCGAGTAGGACTCTTATTCTCTGCAAACT[T/C]
CGTAAAGGATTTCCTTAGTGTATGTAGAGAATGTCCATATATGCGCGGGCATGCCATATCGATATGTAACATATATCGAAGGGTAAAGGGTATACCTAAC

Reverse complement sequence

GTTAGGTATACCCTTTACCCTTCGATATATGTTACATATCGATATGGCATGCCCGCGCATATATGGACATTCTCTACATACACTAAGGAAATCCTTTACG[A/G]
AGTTTGCAGAGAATAAGAGTCCTACTCGGACAGGACTGGGTCGTCAATGTATCGTGTAGGGTCCGATGTCTCCGAGTTCTACTTGGAAACCGCCTGACCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.30%	9.50%	3.43%	55.76%	NA
All Indica	2759	13.60%	9.50%	5.22%	71.69%	NA
All Japonica	1512	69.90%	0.10%	0.66%	29.30%	NA
Aus	269	4.50%	63.20%	1.86%	30.48%	NA
Indica I	595	10.40%	1.50%	1.85%	86.22%	NA
Indica II	465	41.30%	10.30%	5.81%	42.58%	NA
Indica III	913	2.10%	11.00%	7.12%	79.85%	NA
Indica Intermediate	786	13.10%	13.20%	5.22%	68.45%	NA
Temperate Japonica	767	95.00%	0.00%	0.13%	4.82%	NA
Tropical Japonica	504	28.60%	0.40%	1.19%	69.84%	NA
Japonica Intermediate	241	76.30%	0.00%	1.24%	22.41%	NA
VI/Aromatic	96	9.40%	2.10%	1.04%	87.50%	NA
Intermediate	90	28.90%	15.60%	2.22%	53.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0804975611	T -> C	LOC_Os08g08592.1	upstream_gene_variant ; 1757.0bp to feature; MODIFIER	silent_mutation	Average:38.023; most accessible tissue: Minghui63 flower, score: 71.157	N	N	N	N
vg0804975611	T -> C	LOC_Os08g08600.1	upstream_gene_variant ; 562.0bp to feature; MODIFIER	silent_mutation	Average:38.023; most accessible tissue: Minghui63 flower, score: 71.157	N	N	N	N
vg0804975611	T -> C	LOC_Os08g08592.2	upstream_gene_variant ; 1757.0bp to feature; MODIFIER	silent_mutation	Average:38.023; most accessible tissue: Minghui63 flower, score: 71.157	N	N	N	N
vg0804975611	T -> C	LOC_Os08g08592.3	upstream_gene_variant ; 1757.0bp to feature; MODIFIER	silent_mutation	Average:38.023; most accessible tissue: Minghui63 flower, score: 71.157	N	N	N	N
vg0804975611	T -> C	LOC_Os08g08610.1	downstream_gene_variant ; 4521.0bp to feature; MODIFIER	silent_mutation	Average:38.023; most accessible tissue: Minghui63 flower, score: 71.157	N	N	N	N
vg0804975611	T -> C	LOC_Os08g08592-LOC_Os08g08600	intergenic_region ; MODIFIER	silent_mutation	Average:38.023; most accessible tissue: Minghui63 flower, score: 71.157	N	N	N	N
vg0804975611	T -> DEL	N	N	silent_mutation	Average:38.023; most accessible tissue: Minghui63 flower, score: 71.157	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0804975611	7.87E-06	NA	mr1720_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251