Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804864872:

Variant ID: vg0804864872 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4864872
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:


GTCAGGAGAGCAACCATGCGAGGGAGGAGGGTTTGGTCATCGGTTGGAGATAAGAGCGAGGTGGTGGTGGTTGGGAAATGCACCTGATATTTTCTTCTCT[T/C]
CGTCGGGCGCGCGGTAGCCAAACATTTTCGATAATCAATACATATTATTTCTCGTTTCATTATGTATACCTTATACATACTTTTTGACGACATGGTATCT

Reverse complement sequence

AGATACCATGTCGTCAAAAAGTATGTATAAGGTATACATAATGAAACGAGAAATAATATGTATTGATTATCGAAAATGTTTGGCTACCGCGCGCCCGACG[A/G]
AGAGAAGAAAATATCAGGTGCATTTCCCAACCACCACCACCTCGCTCTTATCTCCAACCGATGACCAAACCCTCCTCCCTCGCATGGTTGCTCTCCTGAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.80% 27.40% 0.19% 2.52% NA
All Indica  2759 97.30% 2.50% 0.18% 0.07% NA
All Japonica  1512 13.60% 79.30% 0.20% 6.94% NA
Aus  269 95.90% 1.50% 0.00% 2.60% NA
Indica I  595 95.80% 4.00% 0.17% 0.00% NA
Indica II  465 95.70% 3.70% 0.65% 0.00% NA
Indica III  913 99.70% 0.20% 0.00% 0.11% NA
Indica Intermediate  786 96.60% 3.20% 0.13% 0.13% NA
Temperate Japonica  767 11.00% 87.60% 0.13% 1.30% NA
Tropical Japonica  504 14.30% 72.80% 0.00% 12.90% NA
Japonica Intermediate  241 20.30% 66.40% 0.83% 12.45% NA
VI/Aromatic  96 94.80% 4.20% 0.00% 1.04% NA
Intermediate  90 70.00% 24.40% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804864872 T -> C LOC_Os08g08450.1 upstream_gene_variant ; 3677.0bp to feature; MODIFIER silent_mutation Average:71.227; most accessible tissue: Minghui63 flag leaf, score: 85.836 N N N N
vg0804864872 T -> C LOC_Os08g08440-LOC_Os08g08450 intergenic_region ; MODIFIER silent_mutation Average:71.227; most accessible tissue: Minghui63 flag leaf, score: 85.836 N N N N
vg0804864872 T -> DEL N N silent_mutation Average:71.227; most accessible tissue: Minghui63 flag leaf, score: 85.836 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0804864872 T C 0.07 0.05 0.03 0.03 0.06 0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804864872 NA 7.34E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804864872 NA 2.26E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804864872 NA 4.36E-07 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804864872 NA 3.82E-06 mr1318 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804864872 NA 4.31E-20 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804864872 NA 1.30E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804864872 3.16E-06 1.66E-08 mr1851 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804864872 1.01E-06 1.01E-07 mr1864 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804864872 1.10E-08 NA mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804864872 NA 5.85E-25 mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804864872 NA 3.69E-27 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804864872 NA 2.55E-07 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251