Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804616740:

Variant ID: vg0804616740 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 4616740
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

AGTTTTTCGTGTTCAACTTTGATTGTCCGTCTTATATAAATTTTTTTATAATTCGTATTTTTATTATTGTTAGATGATAAAACATGATTAATATTTTATG[C/T]
GTAACTTGTCTTTTTATTTTTTTCATAATTTTTTTAAATAAGACGGACACGTTGGACACGGAAACCATGGTTTGTCTTTTTTTACCGAGGGAGTACTAAG

Reverse complement sequence

CTTAGTACTCCCTCGGTAAAAAAAGACAAACCATGGTTTCCGTGTCCAACGTGTCCGTCTTATTTAAAAAAATTATGAAAAAAATAAAAAGACAAGTTAC[G/A]
CATAAAATATTAATCATGTTTTATCATCTAACAATAATAAAAATACGAATTATAAAAAAATTTATATAAGACGGACAATCAAAGTTGAACACGAAAAACT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.10%	26.40%	8.46%	18.07%	NA
All Indica	2759	26.00%	34.10%	12.21%	27.73%	NA
All Japonica	1512	95.80%	0.30%	0.40%	3.44%	NA
Aus	269	3.00%	75.50%	15.24%	6.32%	NA
Indica I	595	39.30%	11.30%	13.45%	35.97%	NA
Indica II	465	39.40%	41.30%	5.81%	13.55%	NA
Indica III	913	3.10%	46.20%	16.43%	34.28%	NA
Indica Intermediate	786	34.50%	33.10%	10.18%	22.26%	NA
Temperate Japonica	767	99.70%	0.00%	0.13%	0.13%	NA
Tropical Japonica	504	88.50%	0.80%	0.99%	9.72%	NA
Japonica Intermediate	241	98.80%	0.40%	0.00%	0.83%	NA
VI/Aromatic	96	8.30%	79.20%	9.38%	3.12%	NA
Intermediate	90	47.80%	25.60%	7.78%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0804616740	C -> T	LOC_Os08g08120.1	upstream_gene_variant ; 4006.0bp to feature; MODIFIER	silent_mutation	Average:62.074; most accessible tissue: Minghui63 root, score: 89.741	N	N	N	N
vg0804616740	C -> T	LOC_Os08g08120.3	upstream_gene_variant ; 4006.0bp to feature; MODIFIER	silent_mutation	Average:62.074; most accessible tissue: Minghui63 root, score: 89.741	N	N	N	N
vg0804616740	C -> T	LOC_Os08g08120.2	upstream_gene_variant ; 3822.0bp to feature; MODIFIER	silent_mutation	Average:62.074; most accessible tissue: Minghui63 root, score: 89.741	N	N	N	N
vg0804616740	C -> T	LOC_Os08g08130.1	downstream_gene_variant ; 1254.0bp to feature; MODIFIER	silent_mutation	Average:62.074; most accessible tissue: Minghui63 root, score: 89.741	N	N	N	N
vg0804616740	C -> T	LOC_Os08g08120-LOC_Os08g08130	intergenic_region ; MODIFIER	silent_mutation	Average:62.074; most accessible tissue: Minghui63 root, score: 89.741	N	N	N	N
vg0804616740	C -> DEL	N	N	silent_mutation	Average:62.074; most accessible tissue: Minghui63 root, score: 89.741	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0804616740	NA	7.32E-09	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804616740	NA	4.04E-06	mr1815	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251