Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804343793:

Variant ID: vg0804343793 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4343793
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.03, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


TTGAAATATGCCTATCAAAAATAAATTTTTCAGATTTGGAAATATGACTATCAAAAATAGATGGAGGAAATACTTTGTAAGACAAGTCTATATATTGTTC[T/C]
AGTGACTTTAAACTAAATATTTTAAAAGTTATTAATAGTTAAAGTTATAAAAGTTTGACCTTAATCTACAGTAGAAGGCCACACGCCCACACAGGCCACA

Reverse complement sequence

TGTGGCCTGTGTGGGCGTGTGGCCTTCTACTGTAGATTAAGGTCAAACTTTTATAACTTTAACTATTAATAACTTTTAAAATATTTAGTTTAAAGTCACT[A/G]
GAACAATATATAGACTTGTCTTACAAAGTATTTCCTCCATCTATTTTTGATAGTCATATTTCCAAATCTGAAAAATTTATTTTTGATAGGCATATTTCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.50% 34.30% 0.21% 0.00% NA
All Indica  2759 95.00% 4.80% 0.18% 0.00% NA
All Japonica  1512 5.10% 94.80% 0.07% 0.00% NA
Aus  269 97.80% 1.90% 0.37% 0.00% NA
Indica I  595 93.90% 5.70% 0.34% 0.00% NA
Indica II  465 88.00% 11.80% 0.22% 0.00% NA
Indica III  913 99.00% 1.00% 0.00% 0.00% NA
Indica Intermediate  786 95.30% 4.50% 0.25% 0.00% NA
Temperate Japonica  767 1.80% 98.00% 0.13% 0.00% NA
Tropical Japonica  504 11.50% 88.50% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 57.80% 38.90% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804343793 T -> C LOC_Os08g07760.1 upstream_gene_variant ; 378.0bp to feature; MODIFIER silent_mutation Average:98.645; most accessible tissue: Minghui63 young leaf, score: 99.37 N N N N
vg0804343793 T -> C LOC_Os08g07740-LOC_Os08g07760 intergenic_region ; MODIFIER silent_mutation Average:98.645; most accessible tissue: Minghui63 young leaf, score: 99.37 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0804343793 T C 0.0 0.01 0.02 0.01 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804343793 NA 2.36E-08 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804343793 4.49E-06 NA mr1176 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804343793 NA 1.53E-06 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804343793 NA 1.25E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804343793 NA 1.30E-33 mr1780 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804343793 NA 1.64E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804343793 NA 1.38E-07 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804343793 NA 4.42E-30 mr1105_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804343793 NA 2.36E-09 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804343793 NA 9.01E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251