Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804343386:

Variant ID: vg0804343386 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 4343386
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTTGGATTAGAGGGAGAAAGGAAGGAAAATAACTATGCTTTTTAACATATACTCACTTCGGTTTCATAATTCTTATCATTTTGGATAATGACATGGTTTT[C/G]
AAAATATATCTTTGACTGTATTTTTCTATTGTAATATATCTTTGACTGTATTTTTCTATTGTAATACAGTTATACTTTAACTGTAGTACTCCCTTCATCT

Reverse complement sequence

AGATGAAGGGAGTACTACAGTTAAAGTATAACTGTATTACAATAGAAAAATACAGTCAAAGATATATTACAATAGAAAAATACAGTCAAAGATATATTTT[G/C]
AAAACCATGTCATTATCCAAAATGATAAGAATTATGAAACCGAAGTGAGTATATGTTAAAAAGCATAGTTATTTTCCTTCCTTTCTCCCTCTAATCCAAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.30%	13.90%	1.12%	0.59%	NA
All Indica	2759	84.40%	12.90%	1.85%	0.87%	NA
All Japonica	1512	96.60%	3.40%	0.00%	0.00%	NA
Aus	269	35.70%	62.80%	0.74%	0.74%	NA
Indica I	595	95.60%	0.50%	3.36%	0.50%	NA
Indica II	465	89.50%	8.20%	1.94%	0.43%	NA
Indica III	913	77.90%	19.80%	0.99%	1.31%	NA
Indica Intermediate	786	80.50%	16.90%	1.65%	0.89%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	90.30%	9.70%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	26.00%	74.00%	0.00%	0.00%	NA
Intermediate	90	83.30%	14.40%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0804343386	C -> G	LOC_Os08g07760.1	upstream_gene_variant ; 785.0bp to feature; MODIFIER	silent_mutation	Average:53.138; most accessible tissue: Minghui63 flag leaf, score: 86.159	N	N	N	N
vg0804343386	C -> G	LOC_Os08g07740-LOC_Os08g07760	intergenic_region ; MODIFIER	silent_mutation	Average:53.138; most accessible tissue: Minghui63 flag leaf, score: 86.159	N	N	N	N
vg0804343386	C -> DEL	N	N	silent_mutation	Average:53.138; most accessible tissue: Minghui63 flag leaf, score: 86.159	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0804343386	NA	3.84E-08	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804343386	5.22E-06	NA	mr1176	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804343386	4.64E-06	NA	mr1176	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804343386	NA	9.50E-07	mr1317	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804343386	NA	6.11E-07	mr1587	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804343386	NA	3.56E-07	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804343386	NA	1.25E-33	mr1780	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804343386	NA	4.90E-07	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251