Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804309408:

Variant ID: vg0804309408 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 4309408
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.69, T: 0.33, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:

TGCTTCAAATATATTATTGTCGATGATGACCATGATTATTCAGTGTAGGAAAAGAAAGAGAGGTGCAAGGAAGGGAACTCCTCCCTCTAGCTTCCCCTCC[C/T]
CCACCCCTACCCTCATTACGAATGCTAACTTTGTAGAGTTTGATGGAGCTCATCAGAGCTCACCGAAGCTAGAGAAGGTTGTACTACATTAATCGTATGT

Reverse complement sequence

ACATACGATTAATGTAGTACAACCTTCTCTAGCTTCGGTGAGCTCTGATGAGCTCCATCAAACTCTACAAAGTTAGCATTCGTAATGAGGGTAGGGGTGG[G/A]
GGAGGGGAAGCTAGAGGGAGGAGTTCCCTTCCTTGCACCTCTCTTTCTTTTCCTACACTGAATAATCATGGTCATCATCGACAATAATATATTTGAAGCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.80%	25.10%	0.13%	0.00%	NA
All Indica	2759	87.50%	12.30%	0.18%	0.00%	NA
All Japonica	1512	45.90%	54.00%	0.07%	0.00%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	93.90%	6.10%	0.00%	0.00%	NA
Indica II	465	88.20%	11.80%	0.00%	0.00%	NA
Indica III	913	83.90%	15.80%	0.33%	0.00%	NA
Indica Intermediate	786	86.50%	13.20%	0.25%	0.00%	NA
Temperate Japonica	767	43.20%	56.80%	0.00%	0.00%	NA
Tropical Japonica	504	34.50%	65.50%	0.00%	0.00%	NA
Japonica Intermediate	241	78.40%	21.20%	0.41%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	82.20%	17.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0804309408	C -> T	LOC_Os08g07700.1	upstream_gene_variant ; 4712.0bp to feature; MODIFIER	silent_mutation	Average:53.826; most accessible tissue: Zhenshan97 flower, score: 80.463	N	N	N	N
vg0804309408	C -> T	LOC_Os08g07710.1	upstream_gene_variant ; 2376.0bp to feature; MODIFIER	silent_mutation	Average:53.826; most accessible tissue: Zhenshan97 flower, score: 80.463	N	N	N	N
vg0804309408	C -> T	LOC_Os08g07700-LOC_Os08g07710	intergenic_region ; MODIFIER	silent_mutation	Average:53.826; most accessible tissue: Zhenshan97 flower, score: 80.463	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0804309408	1.93E-06	NA	mr1036	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804309408	1.80E-06	NA	mr1083	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804309408	2.82E-15	1.44E-09	mr1174	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804309408	9.03E-12	1.07E-15	mr1174	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804309408	8.06E-11	5.69E-09	mr1347	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804309408	1.44E-08	1.44E-08	mr1347	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804309408	3.40E-10	NA	mr1174_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804309408	2.88E-11	1.97E-12	mr1174_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804309408	4.41E-06	NA	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804309408	1.50E-07	NA	mr1347_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804309408	2.03E-06	2.03E-06	mr1806_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251