Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804298332:

Variant ID: vg0804298332 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 4298332
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

AGTTCGTTTAATCAGTAAGGTTGTATTTAGTTTCACACCAAAATTGGAAGTTTGAAGAAATTGGAATAATGTGACGGAAAAGTTGGAAGTTTGTGTGTAG[G/A]
AAAGTTCGATGTGACGGAAAAGTTGAAAGTTTGAAGAAAACATGTTGGAATCTAAACAGGGCCTAAGTCTGGTAATTTGAAACAAGGTCATCTTTAGTTT

Reverse complement sequence

AAACTAAAGATGACCTTGTTTCAAATTACCAGACTTAGGCCCTGTTTAGATTCCAACATGTTTTCTTCAAACTTTCAACTTTTCCGTCACATCGAACTTT[C/T]
CTACACACAAACTTCCAACTTTTCCGTCACATTATTCCAATTTCTTCAAACTTCCAATTTTGGTGTGAAACTAAATACAACCTTACTGATTAAACGAACT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.70%	38.60%	0.21%	7.49%	NA
All Indica	2759	82.60%	13.00%	0.22%	4.17%	NA
All Japonica	1512	5.90%	94.00%	0.00%	0.13%	NA
Aus	269	39.40%	0.70%	1.12%	58.74%	NA
Indica I	595	93.10%	6.90%	0.00%	0.00%	NA
Indica II	465	79.40%	12.70%	0.43%	7.53%	NA
Indica III	913	80.70%	15.30%	0.11%	3.83%	NA
Indica Intermediate	786	78.90%	15.00%	0.38%	5.73%	NA
Temperate Japonica	767	3.70%	96.30%	0.00%	0.00%	NA
Tropical Japonica	504	10.90%	88.90%	0.00%	0.20%	NA
Japonica Intermediate	241	2.50%	97.10%	0.00%	0.41%	NA
VI/Aromatic	96	15.60%	13.50%	1.04%	69.79%	NA
Intermediate	90	52.20%	34.40%	0.00%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0804298332	G -> A	LOC_Os08g07690.1	upstream_gene_variant ; 2221.0bp to feature; MODIFIER	silent_mutation	Average:31.729; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0804298332	G -> A	LOC_Os08g07670.1	downstream_gene_variant ; 3819.0bp to feature; MODIFIER	silent_mutation	Average:31.729; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0804298332	G -> A	LOC_Os08g07680.1	downstream_gene_variant ; 595.0bp to feature; MODIFIER	silent_mutation	Average:31.729; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0804298332	G -> A	LOC_Os08g07680-LOC_Os08g07690	intergenic_region ; MODIFIER	silent_mutation	Average:31.729; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0804298332	G -> DEL	N	N	silent_mutation	Average:31.729; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0804298332	NA	1.96E-18	mr1077	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804298332	NA	1.08E-13	mr1592	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804298332	NA	7.31E-08	mr1610	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804298332	1.31E-06	2.92E-12	mr1827	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804298332	NA	2.02E-07	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804298332	NA	1.00E-16	mr1916	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251