Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804261000:

Variant ID: vg0804261000 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 4261000
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:

ACCAGTGTTATGTCCTGGGACTGATATTGAGATCGCGGTTTCGTAGGAAGCGGTTCGCGCCCTTTTTCCTACGACACGCTCATGTCAGGTGTGCCATTGT[T/A]
CGGCGGTGCTAGATTGGGGTGTGACAGGTTGCCCCCACACCCTCACCCATGTGAGGTTCAAATTTCACCGACCCCGTCCCCGCCAATCATGATGGGGATA

Reverse complement sequence

TATCCCCATCATGATTGGCGGGGACGGGGTCGGTGAAATTTGAACCTCACATGGGTGAGGGTGTGGGGGCAACCTGTCACACCCCAATCTAGCACCGCCG[A/T]
ACAATGGCACACCTGACATGAGCGTGTCGTAGGAAAAAGGGCGCGAACCGCTTCCTACGAAACCGCGATCTCAATATCAGTCCCAGGACATAACACTGGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.60%	26.10%	0.30%	0.00%	NA
All Indica	2759	82.30%	17.70%	0.07%	0.00%	NA
All Japonica	1512	52.40%	46.80%	0.79%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	90.10%	9.70%	0.17%	0.00%	NA
Indica II	465	40.40%	59.60%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	80.70%	19.20%	0.13%	0.00%	NA
Temperate Japonica	767	45.00%	54.00%	1.04%	0.00%	NA
Tropical Japonica	504	52.60%	47.00%	0.40%	0.00%	NA
Japonica Intermediate	241	75.90%	23.20%	0.83%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	67.80%	32.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0804261000	T -> A	LOC_Os08g07570.1	upstream_gene_variant ; 4669.0bp to feature; MODIFIER	silent_mutation	Average:67.379; most accessible tissue: Zhenshan97 panicle, score: 83.41	N	N	N	N
vg0804261000	T -> A	LOC_Os08g07590.1	upstream_gene_variant ; 2883.0bp to feature; MODIFIER	silent_mutation	Average:67.379; most accessible tissue: Zhenshan97 panicle, score: 83.41	N	N	N	N
vg0804261000	T -> A	LOC_Os08g07570-LOC_Os08g07590	intergenic_region ; MODIFIER	silent_mutation	Average:67.379; most accessible tissue: Zhenshan97 panicle, score: 83.41	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0804261000	1.71E-06	6.50E-07	mr1174	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804261000	NA	5.49E-06	mr1347	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804261000	NA	3.40E-10	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804261000	9.45E-06	1.66E-06	mr1174_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804261000	5.78E-06	NA	mr1347_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804261000	NA	6.45E-06	mr1510_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804261000	2.24E-06	NA	mr1806_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251