Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804124681:

Variant ID: vg0804124681 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 4124681
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:

CGGTTAATCTTTGCCGTTTTGCGCTGAAAAACGGTCGTGCTTCTCCATAAAAGCGAGGAGGTTATCCTTTGCTAGTTTGTTCAAAAACTAGTTGTTCGTC[A/G]
TCACGTAAGTACGATATCTATTTTCTTTGCTAATTTGTGTGTAAAATAGTCGCTTGATTCCGCGAAAGTGAATTATTCTTGAGAAATCGGTTTCACTAGC

Reverse complement sequence

GCTAGTGAAACCGATTTCTCAAGAATAATTCACTTTCGCGGAATCAAGCGACTATTTTACACACAAATTAGCAAAGAAAATAGATATCGTACTTACGTGA[T/C]
GACGAACAACTAGTTTTTGAACAAACTAGCAAAGGATAACCTCCTCGCTTTTATGGAGAAGCACGACCGTTTTTCAGCGCAAAACGGCAAAGATTAACCG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.60%	37.50%	0.61%	18.24%	NA
All Indica	2759	20.40%	49.90%	1.01%	28.60%	NA
All Japonica	1512	94.30%	1.70%	0.07%	3.90%	NA
Aus	269	3.30%	95.90%	0.00%	0.74%	NA
Indica I	595	13.60%	36.50%	1.51%	48.40%	NA
Indica II	465	63.70%	29.00%	0.86%	6.45%	NA
Indica III	913	1.40%	64.30%	0.88%	33.41%	NA
Indica Intermediate	786	22.10%	55.90%	0.89%	21.12%	NA
Temperate Japonica	767	97.80%	2.20%	0.00%	0.00%	NA
Tropical Japonica	504	86.90%	1.40%	0.20%	11.51%	NA
Japonica Intermediate	241	98.80%	0.80%	0.00%	0.41%	NA
VI/Aromatic	96	12.50%	87.50%	0.00%	0.00%	NA
Intermediate	90	55.60%	31.10%	0.00%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0804124681	A -> G	LOC_Os08g07360.1	upstream_gene_variant ; 1035.0bp to feature; MODIFIER	silent_mutation	Average:26.871; most accessible tissue: Callus, score: 76.725	N	N	N	N
vg0804124681	A -> G	LOC_Os08g07370.1	downstream_gene_variant ; 2387.0bp to feature; MODIFIER	silent_mutation	Average:26.871; most accessible tissue: Callus, score: 76.725	N	N	N	N
vg0804124681	A -> G	LOC_Os08g07360-LOC_Os08g07370	intergenic_region ; MODIFIER	silent_mutation	Average:26.871; most accessible tissue: Callus, score: 76.725	N	N	N	N
vg0804124681	A -> DEL	N	N	silent_mutation	Average:26.871; most accessible tissue: Callus, score: 76.725	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0804124681	NA	3.75E-06	mr1352	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804124681	NA	3.32E-07	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804124681	NA	9.87E-07	mr1839	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804124681	NA	4.69E-17	mr1874	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804124681	NA	2.01E-20	mr1277_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804124681	NA	2.82E-07	mr1277_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804124681	NA	6.31E-11	mr1624_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804124681	NA	2.53E-08	mr1624_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804124681	NA	6.02E-08	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804124681	NA	1.39E-17	mr1817_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804124681	NA	6.44E-25	mr1874_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804124681	NA	1.58E-06	mr1874_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251