Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804123261:

Variant ID: vg0804123261 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 4123261
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.03, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:

GCTTTGCATCCAGCGTACAGAGGCGTCTCGGAATCACTTACCAACCTGCTAAACTTCATTCCATCTCTCTCATTCTAGGCTGGGTCCTCAACGTCACGTA[G/A]
CATGTCTTGCAGCAGATCGTGATCCACATCAACCATTTCACCACCCAATGGAGAAGGTATAAGCATGTCATGCTCATCTTCATCTTCCTGATTATGTGCA

Reverse complement sequence

TGCACATAATCAGGAAGATGAAGATGAGCATGACATGCTTATACCTTCTCCATTGGGTGGTGAAATGGTTGATGTGGATCACGATCTGCTGCAAGACATG[C/T]
TACGTGACGTTGAGGACCCAGCCTAGAATGAGAGAGATGGAATGAAGTTTAGCAGGTTGGTAAGTGATTCCGAGACGCCTCTGTACGCTGGATGCAAAGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.40%	33.70%	15.68%	4.17%	NA
All Indica	2759	25.10%	43.70%	26.35%	4.82%	NA
All Japonica	1512	94.30%	1.70%	0.07%	3.97%	NA
Aus	269	3.70%	95.50%	0.37%	0.37%	NA
Indica I	595	18.20%	32.30%	48.91%	0.67%	NA
Indica II	465	65.80%	19.60%	14.62%	0.00%	NA
Indica III	913	8.30%	56.80%	25.85%	8.98%	NA
Indica Intermediate	786	25.80%	51.40%	16.79%	5.98%	NA
Temperate Japonica	767	97.90%	2.10%	0.00%	0.00%	NA
Tropical Japonica	504	86.70%	1.40%	0.20%	11.71%	NA
Japonica Intermediate	241	98.80%	0.80%	0.00%	0.41%	NA
VI/Aromatic	96	13.50%	84.40%	2.08%	0.00%	NA
Intermediate	90	56.70%	28.90%	11.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0804123261	G -> A	LOC_Os08g07350.1	upstream_gene_variant ; 4883.0bp to feature; MODIFIER	silent_mutation	Average:30.107; most accessible tissue: Minghui63 flag leaf, score: 61.847	N	N	N	N
vg0804123261	G -> A	LOC_Os08g07370.1	downstream_gene_variant ; 3807.0bp to feature; MODIFIER	silent_mutation	Average:30.107; most accessible tissue: Minghui63 flag leaf, score: 61.847	N	N	N	N
vg0804123261	G -> A	LOC_Os08g07360.1	intron_variant ; MODIFIER	silent_mutation	Average:30.107; most accessible tissue: Minghui63 flag leaf, score: 61.847	N	N	N	N
vg0804123261	G -> DEL	N	N	silent_mutation	Average:30.107; most accessible tissue: Minghui63 flag leaf, score: 61.847	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0804123261	NA	3.05E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804123261	NA	1.82E-07	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804123261	NA	4.76E-19	mr1874	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804123261	NA	4.13E-16	mr1277_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804123261	NA	1.30E-07	mr1482_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804123261	NA	4.72E-24	mr1874_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804123261	NA	1.67E-06	mr1874_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251