Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804004561:

Variant ID: vg0804004561 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4004561
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCAGACTTCAGAAAAGAGAGGGAGAGGGCTGCAGACTGAGAGGAGACTGGGCCGAGAGTGAGAGGACTTTTCCAAATTCGGCCCGAAAAGGAAAAGGTGA[A/T]
TTTAATTACTTTTCCAATTAAATTAATCACTGAAATGATCTTTGAATTGTTAAAAATACTTCCAATGCTCAAATAATTTCAAGAAAAATCCTGAAAATAC

Reverse complement sequence

GTATTTTCAGGATTTTTCTTGAAATTATTTGAGCATTGGAAGTATTTTTAACAATTCAAAGATCATTTCAGTGATTAATTTAATTGGAAAAGTAATTAAA[T/A]
TCACCTTTTCCTTTTCGGGCCGAATTTGGAAAAGTCCTCTCACTCTCGGCCCAGTCTCCTCTCAGTCTGCAGCCCTCTCCCTCTCTTTTCTGAAGTCTGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.30% 1.40% 18.60% 34.68% NA
All Indica  2759 22.20% 2.20% 22.65% 52.88% NA
All Japonica  1512 94.40% 0.00% 4.37% 1.19% NA
Aus  269 13.00% 1.90% 44.24% 40.89% NA
Indica I  595 10.30% 0.70% 17.65% 71.43% NA
Indica II  465 73.10% 0.40% 10.75% 15.70% NA
Indica III  913 3.60% 4.60% 33.52% 58.27% NA
Indica Intermediate  786 22.80% 1.80% 20.87% 54.58% NA
Temperate Japonica  767 98.00% 0.00% 0.13% 1.83% NA
Tropical Japonica  504 87.30% 0.00% 12.30% 0.40% NA
Japonica Intermediate  241 97.90% 0.00% 1.24% 0.83% NA
VI/Aromatic  96 13.50% 0.00% 57.29% 29.17% NA
Intermediate  90 56.70% 1.10% 15.56% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804004561 A -> T LOC_Os08g07140.1 upstream_gene_variant ; 3176.0bp to feature; MODIFIER silent_mutation Average:60.561; most accessible tissue: Minghui63 young leaf, score: 97.964 N N N N
vg0804004561 A -> T LOC_Os08g07160.1 downstream_gene_variant ; 855.0bp to feature; MODIFIER silent_mutation Average:60.561; most accessible tissue: Minghui63 young leaf, score: 97.964 N N N N
vg0804004561 A -> T LOC_Os08g07140-LOC_Os08g07160 intergenic_region ; MODIFIER silent_mutation Average:60.561; most accessible tissue: Minghui63 young leaf, score: 97.964 N N N N
vg0804004561 A -> DEL N N silent_mutation Average:60.561; most accessible tissue: Minghui63 young leaf, score: 97.964 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0804004561 A T -0.01 -0.01 -0.02 -0.01 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804004561 2.28E-06 NA Heading_date Ind_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0804004561 NA 2.12E-13 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804004561 NA 7.30E-10 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804004561 NA 4.24E-19 mr1874_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251