Variant ID: vg0803730363 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 3730363 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ATTAATTGTGTATTAAATATTTTATGATTAATTGTGTATTAAATATTTTAGACTTAAAAATTAATTTTTGAGAGAAGAGAAAAGGAGAAGATTGAACAGA[T/C]
GCGCAAAACAAGGTGAACGATTAACTATGATTATTTGTTTACTAATTATTCCAAACTTAAAAAAACAAATTAATATGATTTATTAAATCAACTTTTTAAA
TTTAAAAAGTTGATTTAATAAATCATATTAATTTGTTTTTTTAAGTTTGGAATAATTAGTAAACAAATAATCATAGTTAATCGTTCACCTTGTTTTGCGC[A/G]
TCTGTTCAATCTTCTCCTTTTCTCTTCTCTCAAAAATTAATTTTTAAGTCTAAAATATTTAATACACAATTAATCATAAAATATTTAATACACAATTAAT
Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 95.70% | 3.80% | 0.55% | 0.00% | NA |
All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 86.80% | 11.60% | 1.59% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 82.90% | 14.60% | 2.48% | 0.00% | NA |
Tropical Japonica | 504 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 74.70% | 23.20% | 2.07% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 96.70% | 1.10% | 2.22% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0803730363 | T -> C | LOC_Os08g06600.1 | upstream_gene_variant ; 4117.0bp to feature; MODIFIER | silent_mutation | Average:35.07; most accessible tissue: Minghui63 flag leaf, score: 48.324 | N | N | N | N |
vg0803730363 | T -> C | LOC_Os08g06620.1 | upstream_gene_variant ; 1519.0bp to feature; MODIFIER | silent_mutation | Average:35.07; most accessible tissue: Minghui63 flag leaf, score: 48.324 | N | N | N | N |
vg0803730363 | T -> C | LOC_Os08g06630.1 | upstream_gene_variant ; 2078.0bp to feature; MODIFIER | silent_mutation | Average:35.07; most accessible tissue: Minghui63 flag leaf, score: 48.324 | N | N | N | N |
vg0803730363 | T -> C | LOC_Os08g06630.3 | upstream_gene_variant ; 2152.0bp to feature; MODIFIER | silent_mutation | Average:35.07; most accessible tissue: Minghui63 flag leaf, score: 48.324 | N | N | N | N |
vg0803730363 | T -> C | LOC_Os08g06610.1 | downstream_gene_variant ; 2902.0bp to feature; MODIFIER | silent_mutation | Average:35.07; most accessible tissue: Minghui63 flag leaf, score: 48.324 | N | N | N | N |
vg0803730363 | T -> C | LOC_Os08g06620-LOC_Os08g06630 | intergenic_region ; MODIFIER | silent_mutation | Average:35.07; most accessible tissue: Minghui63 flag leaf, score: 48.324 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0803730363 | 3.51E-07 | NA | mr1300 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0803730363 | 3.88E-06 | NA | mr1310 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0803730363 | 8.88E-06 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0803730363 | 2.98E-06 | 2.98E-06 | mr1445_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |